Incidental Mutation 'R4291:Cckar'
ID323055
Institutional Source Beutler Lab
Gene Symbol Cckar
Ensembl Gene ENSMUSG00000029193
Gene Namecholecystokinin A receptor
Synonyms
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location53697776-53707705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53706497 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000031093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031093] [ENSMUST00000200691]
Predicted Effect probably benign
Transcript: ENSMUST00000031093
AA Change: S41P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031093
Gene: ENSMUSG00000029193
AA Change: S41P

DomainStartEndE-ValueType
Pfam:CholecysA-Rec_N 1 47 8.8e-29 PFAM
Pfam:7tm_4 48 252 7.2e-12 PFAM
Pfam:7TM_GPCR_Srsx 52 393 2.6e-10 PFAM
Pfam:7tm_1 58 378 1.1e-66 PFAM
low complexity region 399 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200691
SMART Domains Protein: ENSMUSP00000144103
Gene: ENSMUSG00000029193

DomainStartEndE-ValueType
Pfam:7tm_1 1 307 1.6e-59 PFAM
Pfam:7tm_4 3 181 1.8e-6 PFAM
low complexity region 328 345 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202946
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor that binds non-sulfated members of the cholecystokinin (CCK) family of peptide hormones. This receptor is a major physiologic mediator of pancreatic enzyme secretion and smooth muscle contraction of the gallbladder and stomach. In the central and peripheral nervous system this receptor regulates satiety and the release of beta-endorphin and dopamine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice cannot regulate core body temperature in response to changes in ambient temperature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Cckar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cckar APN 5 53699829 missense possibly damaging 0.86
IGL00568:Cckar APN 5 53707301 missense probably benign 0.02
IGL00766:Cckar APN 5 53700036 missense probably damaging 0.99
IGL00960:Cckar APN 5 53701292 missense probably damaging 1.00
IGL02424:Cckar APN 5 53706428 missense possibly damaging 0.63
IGL03002:Cckar APN 5 53702905 missense probably damaging 0.99
R0167:Cckar UTSW 5 53706453 missense probably damaging 1.00
R0302:Cckar UTSW 5 53700299 frame shift probably null
R0366:Cckar UTSW 5 53700165 missense probably benign 0.01
R0391:Cckar UTSW 5 53706253 critical splice donor site probably null
R0981:Cckar UTSW 5 53706290 missense probably damaging 1.00
R1619:Cckar UTSW 5 53700067 missense probably damaging 1.00
R1644:Cckar UTSW 5 53699873 missense probably benign
R1779:Cckar UTSW 5 53699979 missense probably damaging 1.00
R2184:Cckar UTSW 5 53702912 missense probably damaging 0.96
R4290:Cckar UTSW 5 53706497 missense probably benign
R4292:Cckar UTSW 5 53706497 missense probably benign
R4294:Cckar UTSW 5 53706497 missense probably benign
R4518:Cckar UTSW 5 53699922 missense probably damaging 1.00
R4583:Cckar UTSW 5 53699782 missense probably benign 0.01
R5139:Cckar UTSW 5 53702923 missense probably benign 0.00
R5505:Cckar UTSW 5 53703068 missense probably damaging 1.00
R6207:Cckar UTSW 5 53699844 missense probably benign
R6415:Cckar UTSW 5 53703056 missense probably damaging 1.00
R7127:Cckar UTSW 5 53706475 missense probably damaging 1.00
R7372:Cckar UTSW 5 53707282 missense probably damaging 0.99
R7966:Cckar UTSW 5 53701238 missense possibly damaging 0.65
X0028:Cckar UTSW 5 53707273 missense probably benign 0.22
X0028:Cckar UTSW 5 53707274 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGGTTGAACGGCATGCAG -3'
(R):5'- AACTGCTTTCCTGACGGATCC -3'

Sequencing Primer
(F):5'- TTGAACGGCATGCAGAAGAG -3'
(R):5'- TCCTGACGGATCCCATTAACATC -3'
Posted On2015-06-20