Incidental Mutation 'R4291:Krba1'
ID323057
Institutional Source Beutler Lab
Gene Symbol Krba1
Ensembl Gene ENSMUSG00000042810
Gene NameKRAB-A domain containing 1
SynonymsA930040G15Rik
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48395586-48419781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48415665 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 802 (P802S)
Ref Sequence ENSEMBL: ENSMUSP00000145256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031815] [ENSMUST00000077093] [ENSMUST00000114571] [ENSMUST00000114572] [ENSMUST00000203371]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031815
AA Change: P792S

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031815
Gene: ENSMUSG00000042810
AA Change: P792S

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
KRBA1 154 197 1.27e-3 SMART
KRBA1 249 291 3.23e-14 SMART
KRBA1 310 355 8.27e-12 SMART
KRBA1 357 399 4.98e-6 SMART
low complexity region 452 459 N/A INTRINSIC
KRBA1 474 516 6.03e-14 SMART
KRBA1 576 619 7.71e-12 SMART
coiled coil region 814 847 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077093
AA Change: P803S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000076345
Gene: ENSMUSG00000042810
AA Change: P803S

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 193 235 3.23e-14 SMART
KRBA1 254 299 8.27e-12 SMART
KRBA1 367 409 7.26e-8 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 6.03e-14 SMART
KRBA1 586 629 7.71e-12 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114571
AA Change: P803S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000110218
Gene: ENSMUSG00000042810
AA Change: P803S

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 193 235 3.23e-14 SMART
KRBA1 254 299 8.27e-12 SMART
KRBA1 367 409 7.26e-8 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 6.03e-14 SMART
KRBA1 586 629 7.71e-12 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114572
AA Change: P838S

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110219
Gene: ENSMUSG00000042810
AA Change: P838S

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 194 236 3.23e-14 SMART
KRBA1 255 300 8.27e-12 SMART
KRBA1 368 410 7.26e-8 SMART
low complexity region 463 470 N/A INTRINSIC
KRBA1 485 527 6.03e-14 SMART
KRBA1 587 630 7.71e-12 SMART
coiled coil region 825 858 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154536
Predicted Effect possibly damaging
Transcript: ENSMUST00000203371
AA Change: P802S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145256
Gene: ENSMUSG00000042810
AA Change: P802S

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 97 140 8.1e-8 SMART
KRBA1 193 235 2.5e-18 SMART
KRBA1 254 299 6.4e-16 SMART
KRBA1 367 409 5.7e-12 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 4.6e-18 SMART
KRBA1 586 629 5.8e-16 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204554
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Krba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Krba1 APN 6 48406318 missense possibly damaging 0.95
IGL01663:Krba1 APN 6 48411754 missense probably damaging 0.99
IGL01764:Krba1 APN 6 48415836 missense probably benign 0.01
IGL02036:Krba1 APN 6 48415642 missense possibly damaging 0.95
IGL02333:Krba1 APN 6 48413087 missense probably damaging 0.99
IGL02681:Krba1 APN 6 48404118 missense probably damaging 1.00
IGL03069:Krba1 APN 6 48414549 missense possibly damaging 0.53
IGL03380:Krba1 APN 6 48403453 missense possibly damaging 0.53
PIT4151001:Krba1 UTSW 6 48402897 missense probably damaging 0.99
R0077:Krba1 UTSW 6 48405225 splice site probably benign
R0504:Krba1 UTSW 6 48416254 missense probably benign 0.07
R1051:Krba1 UTSW 6 48413398 missense possibly damaging 0.82
R1875:Krba1 UTSW 6 48414049 splice site probably null
R1912:Krba1 UTSW 6 48415765 missense probably benign 0.45
R2084:Krba1 UTSW 6 48414568 missense probably damaging 1.00
R4035:Krba1 UTSW 6 48411680 missense probably damaging 1.00
R4568:Krba1 UTSW 6 48409723 missense probably damaging 0.98
R4619:Krba1 UTSW 6 48406348 nonsense probably null
R4638:Krba1 UTSW 6 48409751 nonsense probably null
R4913:Krba1 UTSW 6 48406957 missense probably benign 0.00
R5174:Krba1 UTSW 6 48412295 missense probably damaging 1.00
R5487:Krba1 UTSW 6 48404039 missense probably damaging 1.00
R5496:Krba1 UTSW 6 48406356 missense possibly damaging 0.54
R5514:Krba1 UTSW 6 48413495 missense probably damaging 1.00
R5879:Krba1 UTSW 6 48415744 missense possibly damaging 0.89
R6351:Krba1 UTSW 6 48414128 missense probably benign 0.35
R6516:Krba1 UTSW 6 48413272 nonsense probably null
R7003:Krba1 UTSW 6 48413080 missense possibly damaging 0.71
R7135:Krba1 UTSW 6 48416299 missense probably benign 0.01
R7202:Krba1 UTSW 6 48412327 missense probably damaging 1.00
R7308:Krba1 UTSW 6 48406339 missense probably benign 0.04
R7936:Krba1 UTSW 6 48411669 missense probably damaging 1.00
Z1177:Krba1 UTSW 6 48413256 missense probably damaging 1.00
Z1177:Krba1 UTSW 6 48415894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAAATTCTCTGGAAACCCGGC -3'
(R):5'- AGGAACCCTGACCTTTTGGG -3'

Sequencing Primer
(F):5'- TCTGGAAACCCGGCCTTATG -3'
(R):5'- ACCTTTTGGGCCAAGGCTC -3'
Posted On2015-06-20