Incidental Mutation 'R4291:Nucb1'
ID323064
Institutional Source Beutler Lab
Gene Symbol Nucb1
Ensembl Gene ENSMUSG00000030824
Gene Namenucleobindin 1
SynonymsB230337F23Rik, Calnuc, MTEST82
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45490458-45510406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45495280 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 283 (D283V)
Ref Sequence ENSEMBL: ENSMUSP00000147383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033096] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000210813] [ENSMUST00000211343] [ENSMUST00000211682] [ENSMUST00000211765]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033096
AA Change: D283V

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033096
Gene: ENSMUSG00000030824
AA Change: D283V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:EF-hand_7 227 319 2.1e-9 PFAM
coiled coil region 340 407 N/A INTRINSIC
low complexity region 420 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107758
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107759
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210394
Predicted Effect unknown
Transcript: ENSMUST00000210449
AA Change: D149V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210675
Predicted Effect probably benign
Transcript: ENSMUST00000210813
Predicted Effect probably benign
Transcript: ENSMUST00000211343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211413
Predicted Effect probably benign
Transcript: ENSMUST00000211682
Predicted Effect probably damaging
Transcript: ENSMUST00000211765
AA Change: D283V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8019 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small calcium-binding EF-hand protein family. The encoded protein is thought to have a key role in Golgi calcium homeostasis and Ca(2+)-regulated signal transduction events. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Nucb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nucb1 APN 7 45501651 missense probably damaging 1.00
IGL02496:Nucb1 APN 7 45495043 splice site probably benign
R1509:Nucb1 UTSW 7 45495225 missense probably benign 0.06
R1663:Nucb1 UTSW 7 45498864 missense probably damaging 1.00
R3499:Nucb1 UTSW 7 45498876 missense probably benign 0.01
R4983:Nucb1 UTSW 7 45498889 missense probably damaging 1.00
R5307:Nucb1 UTSW 7 45498418 missense probably damaging 0.98
R5739:Nucb1 UTSW 7 45501660 missense probably damaging 1.00
R6822:Nucb1 UTSW 7 45498865 missense probably damaging 1.00
R6874:Nucb1 UTSW 7 45503194 missense probably benign 0.13
R6927:Nucb1 UTSW 7 45498858 missense possibly damaging 0.58
R7424:Nucb1 UTSW 7 45498778 missense possibly damaging 0.68
R7514:Nucb1 UTSW 7 45501718 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACTCCTTCCTCTGGGTGGATG -3'
(R):5'- TCTGCTTTCCTGTCAGTGAG -3'

Sequencing Primer
(F):5'- TGGATGCCAGGAACTCCTC -3'
(R):5'- GGTAAGTCCCCCAAGAG -3'
Posted On2015-06-20