Incidental Mutation 'R4291:Olfr310'
ID323065
Institutional Source Beutler Lab
Gene Symbol Olfr310
Ensembl Gene ENSMUSG00000057540
Gene Nameolfactory receptor 310
SynonymsGA_x6K02T2NHDJ-9838699-9839697, MOR227-6P
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86268487-86277172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86269760 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 10 (F10I)
Ref Sequence ENSEMBL: ENSMUSP00000151989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081918] [ENSMUST00000217724]
Predicted Effect probably damaging
Transcript: ENSMUST00000081918
AA Change: F10I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080589
Gene: ENSMUSG00000057540
AA Change: F10I

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 8.9e-46 PFAM
Pfam:7tm_1 39 289 1.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217724
AA Change: F10I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4674 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Olfr310
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Olfr310 APN 7 86269669 missense probably damaging 1.00
IGL00917:Olfr310 APN 7 86269441 missense probably damaging 1.00
IGL02145:Olfr310 APN 7 86269258 missense probably damaging 1.00
IGL02639:Olfr310 APN 7 86269720 missense probably damaging 0.99
R0139:Olfr310 UTSW 7 86268979 missense probably benign 0.00
R0554:Olfr310 UTSW 7 86269657 missense probably damaging 0.99
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1474:Olfr310 UTSW 7 86269062 missense probably damaging 1.00
R2379:Olfr310 UTSW 7 86269649 missense probably damaging 1.00
R3692:Olfr310 UTSW 7 86269495 missense probably damaging 1.00
R4290:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4295:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R5071:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5072:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5074:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5828:Olfr310 UTSW 7 86269520 missense probably benign 0.00
R6174:Olfr310 UTSW 7 86268801 missense probably benign
R6207:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R6493:Olfr310 UTSW 7 86268882 missense probably benign 0.21
R7068:Olfr310 UTSW 7 86269537 missense probably damaging 1.00
R7196:Olfr310 UTSW 7 86269441 missense probably damaging 1.00
R7694:Olfr310 UTSW 7 86269775 missense probably damaging 1.00
R7794:Olfr310 UTSW 7 86269133 missense probably damaging 0.99
Z1176:Olfr310 UTSW 7 86268947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTAAAATGGACAGATTCCTGAGG -3'
(R):5'- CTGGACAGATAGGTATAACTCTGTG -3'

Sequencing Primer
(F):5'- TTCCTGAGGAAGAAGTACATGG -3'
(R):5'- ATTAAGTTATTCCTTGTCC -3'
Posted On2015-06-20