Incidental Mutation 'R4291:Mapkapk3'
ID323067
Institutional Source Beutler Lab
Gene Symbol Mapkapk3
Ensembl Gene ENSMUSG00000032577
Gene Namemitogen-activated protein kinase-activated protein kinase 3
SynonymsMK3
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107254927-107289877 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 107258932 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035194] [ENSMUST00000134682] [ENSMUST00000192054]
Predicted Effect probably benign
Transcript: ENSMUST00000035194
SMART Domains Protein: ENSMUSP00000035194
Gene: ENSMUSG00000032577

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
S_TKc 45 306 4.97e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128175
Predicted Effect probably benign
Transcript: ENSMUST00000134682
SMART Domains Protein: ENSMUSP00000120848
Gene: ENSMUSG00000032577

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155860
Predicted Effect probably benign
Transcript: ENSMUST00000192054
SMART Domains Protein: ENSMUSP00000141342
Gene: ENSMUSG00000032577

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
Pfam:Pkinase 46 264 6.3e-48 PFAM
Pfam:Pkinase_Tyr 47 259 1.1e-27 PFAM
Pfam:Kdo 80 202 1.1e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family. This kinase functions as a mitogen-activated protein kinase (MAP kinase)- activated protein kinase. MAP kinases are also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This kinase was shown to be activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses. This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display normal tissue morphology, behavior, and LPS-induced production of cytokines. Eyes of homozygous null mice show defects in Bruch's membrane, with disorganized architecture and variability in thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Mapkapk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Mapkapk3 APN 9 107262422 critical splice donor site probably null
IGL02486:Mapkapk3 APN 9 107289268 missense probably damaging 1.00
IGL02971:Mapkapk3 APN 9 107257080 missense probably benign 0.00
R1523:Mapkapk3 UTSW 9 107263623 critical splice donor site probably null
R4106:Mapkapk3 UTSW 9 107257066 missense probably damaging 0.99
R4290:Mapkapk3 UTSW 9 107258932 intron probably benign
R4293:Mapkapk3 UTSW 9 107258932 intron probably benign
R4294:Mapkapk3 UTSW 9 107258932 intron probably benign
R4299:Mapkapk3 UTSW 9 107257449 missense probably damaging 1.00
R5433:Mapkapk3 UTSW 9 107256292 missense probably damaging 0.96
R5936:Mapkapk3 UTSW 9 107289170 missense probably damaging 0.96
R6029:Mapkapk3 UTSW 9 107289226 missense possibly damaging 0.86
R6228:Mapkapk3 UTSW 9 107260063 missense probably damaging 1.00
R6520:Mapkapk3 UTSW 9 107257449 missense probably damaging 1.00
R7011:Mapkapk3 UTSW 9 107289396 unclassified probably benign
R7352:Mapkapk3 UTSW 9 107257070 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGCCTTGACATGAGGAAGCC -3'
(R):5'- GGGGTTTGTCTGAAAGCAGC -3'

Sequencing Primer
(F):5'- GGCAGTTTCAAGGCCTGTATCTAAC -3'
(R):5'- TCACACACATGCTGCCT -3'
Posted On2015-06-20