Incidental Mutation 'R4291:Mcm9'
ID323068
Institutional Source Beutler Lab
Gene Symbol Mcm9
Ensembl Gene ENSMUSG00000058298
Gene Nameminichromosome maintenance 9 homologous recombination repair factor
SynonymsMcmdc1, 9030408O17Rik
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location53536315-53630439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53547572 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 677 (M677I)
Ref Sequence ENSEMBL: ENSMUSP00000074978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075540] [ENSMUST00000219547] [ENSMUST00000220007]
Predicted Effect probably benign
Transcript: ENSMUST00000075540
AA Change: M677I

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000074978
Gene: ENSMUSG00000058298
AA Change: M677I

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 81 111 N/A INTRINSIC
MCM 268 761 9.44e-116 SMART
AAA 500 649 2.43e-6 SMART
coiled coil region 789 817 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1028 N/A INTRINSIC
low complexity region 1045 1056 N/A INTRINSIC
low complexity region 1199 1216 N/A INTRINSIC
low complexity region 1219 1232 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219547
Predicted Effect probably benign
Transcript: ENSMUST00000220007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220260
Meta Mutation Damage Score 0.1154 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the mini-chromosome maintenance (MCM) protein family that are essential for the initiation of eukaryotic genome replication. Binding of this protein to chromatin has been shown to be a pre-requisite for recruiting the MCM2-7 helicase to DNA replication origins. This protein also binds, and is a positive regulator of, the chromatin licensing and DNA replication factor 1, CDT1. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for gene trap alleles display germ cell loss with reduced fertility or infertility and increased tumor incidence, particulary of hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Mcm9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Mcm9 APN 10 53622973 missense probably damaging 0.97
IGL00904:Mcm9 APN 10 53622921 missense possibly damaging 0.89
IGL00943:Mcm9 APN 10 53548589 missense probably damaging 1.00
IGL01019:Mcm9 APN 10 53629945 missense probably damaging 1.00
IGL02452:Mcm9 APN 10 53541557 missense probably damaging 1.00
IGL02481:Mcm9 APN 10 53625937 missense probably damaging 1.00
IGL02982:Mcm9 APN 10 53625826 missense probably damaging 0.99
IGL03300:Mcm9 APN 10 53611427 missense probably damaging 1.00
R0021:Mcm9 UTSW 10 53537901 missense possibly damaging 0.94
R0117:Mcm9 UTSW 10 53537736 missense possibly damaging 0.49
R0137:Mcm9 UTSW 10 53563430 missense possibly damaging 0.95
R0420:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R0499:Mcm9 UTSW 10 53538154 missense probably benign 0.01
R0543:Mcm9 UTSW 10 53541598 missense probably damaging 0.97
R0947:Mcm9 UTSW 10 53537501 small deletion probably benign
R0975:Mcm9 UTSW 10 53538646 nonsense probably null
R1573:Mcm9 UTSW 10 53548656 missense probably damaging 0.97
R1726:Mcm9 UTSW 10 53537881 missense possibly damaging 0.67
R1839:Mcm9 UTSW 10 53541553 missense probably damaging 0.99
R2050:Mcm9 UTSW 10 53612825 critical splice donor site probably null
R2113:Mcm9 UTSW 10 53615847 splice site probably null
R2172:Mcm9 UTSW 10 53548574 missense probably damaging 1.00
R3417:Mcm9 UTSW 10 53537407 missense possibly damaging 0.83
R3755:Mcm9 UTSW 10 53625952 missense probably benign 0.08
R3787:Mcm9 UTSW 10 53615980 missense possibly damaging 0.78
R3789:Mcm9 UTSW 10 53616017 missense probably damaging 1.00
R3953:Mcm9 UTSW 10 53563344 missense probably damaging 1.00
R4358:Mcm9 UTSW 10 53537653 missense probably benign 0.03
R4660:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R4662:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R5082:Mcm9 UTSW 10 53538060 missense possibly damaging 0.94
R5130:Mcm9 UTSW 10 53630399 missense possibly damaging 0.90
R5193:Mcm9 UTSW 10 53616038 missense probably damaging 0.99
R5238:Mcm9 UTSW 10 53629997 missense possibly damaging 0.83
R5317:Mcm9 UTSW 10 53538234 missense probably damaging 1.00
R5395:Mcm9 UTSW 10 53538692 missense possibly damaging 0.93
R5524:Mcm9 UTSW 10 53548690 nonsense probably null
R5593:Mcm9 UTSW 10 53538297 missense probably damaging 0.99
R5748:Mcm9 UTSW 10 53625729 missense probably damaging 1.00
R6025:Mcm9 UTSW 10 53615977 missense possibly damaging 0.93
R6299:Mcm9 UTSW 10 53537681 missense probably damaging 1.00
R6344:Mcm9 UTSW 10 53537937 missense probably benign 0.03
R6502:Mcm9 UTSW 10 53612839 missense probably damaging 1.00
R6621:Mcm9 UTSW 10 53563313 missense probably damaging 1.00
R6883:Mcm9 UTSW 10 53616014 missense probably damaging 1.00
R6932:Mcm9 UTSW 10 53620203 missense probably benign 0.06
R6963:Mcm9 UTSW 10 53548617 missense probably damaging 1.00
R7094:Mcm9 UTSW 10 53620157 missense probably damaging 1.00
R7114:Mcm9 UTSW 10 53538573 missense possibly damaging 0.55
R7200:Mcm9 UTSW 10 53615923 missense
R7593:Mcm9 UTSW 10 53629992 missense probably benign 0.04
R7671:Mcm9 UTSW 10 53537569 missense probably benign 0.01
R7697:Mcm9 UTSW 10 53615894 missense
R7997:Mcm9 UTSW 10 53597406 start gained probably benign
R8136:Mcm9 UTSW 10 53611343 makesense probably null
R8137:Mcm9 UTSW 10 53622980 missense
Z1176:Mcm9 UTSW 10 53537507 missense unknown
Z1176:Mcm9 UTSW 10 53629788 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTTCTGCTAATCGGATCAAGC -3'
(R):5'- AAAACGTGTGTAGGAGCTTTTG -3'

Sequencing Primer
(F):5'- TCAAGCTTTCTAACAGGCGG -3'
(R):5'- CACCTTTACATAGTGAGTATCAGGGC -3'
Posted On2015-06-20