Incidental Mutation 'R4291:Olfr1396'
ID323070
Institutional Source Beutler Lab
Gene Symbol Olfr1396
Ensembl Gene ENSMUSG00000047511
Gene Nameolfactory receptor 1396
SynonymsGA_x6K02T2QP88-6321048-6321995, MOR276-2
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49109982-49114874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49113427 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 100 (I100L)
Ref Sequence ENSEMBL: ENSMUSP00000150961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056759] [ENSMUST00000060398] [ENSMUST00000102785] [ENSMUST00000109201] [ENSMUST00000179282] [ENSMUST00000203007] [ENSMUST00000203149] [ENSMUST00000203810] [ENSMUST00000215553]
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060398
AA Change: I100L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056876
Gene: ENSMUSG00000047511
AA Change: I100L

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 3.2e-46 PFAM
Pfam:7tm_1 53 302 7.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102785
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109201
AA Change: I100L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104824
Gene: ENSMUSG00000047511
AA Change: I100L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 252 1e-5 PFAM
Pfam:7tm_1 42 291 4e-35 PFAM
Pfam:7tm_4 140 284 5.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203007
AA Change: I100L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000145057
Gene: ENSMUSG00000047511
AA Change: I100L

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 9.6e-47 PFAM
Pfam:7TM_GPCR_Srsx 36 252 1e-5 PFAM
Pfam:7tm_1 42 291 3.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203149
SMART Domains Protein: ENSMUSP00000145429
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203412
Predicted Effect probably benign
Transcript: ENSMUST00000203810
SMART Domains Protein: ENSMUSP00000144951
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215553
AA Change: I100L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0740 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Olfr1396
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr1396 APN 11 49112853 missense probably damaging 1.00
IGL01514:Olfr1396 APN 11 49113576 missense probably damaging 1.00
IGL03188:Olfr1396 APN 11 49113709 missense probably damaging 1.00
R0314:Olfr1396 UTSW 11 49113692 missense possibly damaging 0.54
R1242:Olfr1396 UTSW 11 49112901 missense possibly damaging 0.95
R1625:Olfr1396 UTSW 11 49113244 missense probably benign 0.01
R2212:Olfr1396 UTSW 11 49113216 missense probably damaging 1.00
R4290:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4292:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4294:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4295:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4351:Olfr1396 UTSW 11 49113703 missense probably damaging 0.99
R4817:Olfr1396 UTSW 11 49113621 missense probably damaging 1.00
R4859:Olfr1396 UTSW 11 49113166 missense probably damaging 1.00
R5245:Olfr1396 UTSW 11 49113289 missense probably benign 0.12
R5350:Olfr1396 UTSW 11 49113052 missense probably benign 0.00
R6625:Olfr1396 UTSW 11 49113069 missense probably damaging 1.00
R7529:Olfr1396 UTSW 11 49112859 missense probably damaging 1.00
X0024:Olfr1396 UTSW 11 49113311 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GGTCATTACCACTACCATCTGC -3'
(R):5'- GGTCATGCTGGTCTTCACAG -3'

Sequencing Primer
(F):5'- TGCACCAGACCATCTGCTATC -3'
(R):5'- TGGTCTTCACAGCAGCATTG -3'
Posted On2015-06-20