Incidental Mutation 'R4291:Rps6kb1'
ID323073
Institutional Source Beutler Lab
Gene Symbol Rps6kb1
Ensembl Gene ENSMUSG00000020516
Gene Nameribosomal protein S6 kinase, polypeptide 1
Synonymsp70s6k, 2610318I15Rik, S6K1, p70/85s6k
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86498871-86544805 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 86519876 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058286] [ENSMUST00000154617]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000020824
Predicted Effect probably benign
Transcript: ENSMUST00000058286
SMART Domains Protein: ENSMUSP00000053188
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
Pfam:Pkinase 91 202 1.2e-19 PFAM
Pfam:Pkinase_Tyr 91 253 5.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151748
Predicted Effect probably benign
Transcript: ENSMUST00000154617
SMART Domains Protein: ENSMUSP00000119715
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
S_TKc 91 352 8.24e-107 SMART
S_TK_X 353 415 9.2e-27 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced prenatal growth, glucose intolerance, and hypoinsulinemia associated with diminished pancreatic beta cell size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Rps6kb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Rps6kb1 APN 11 86502766 missense probably benign
IGL02707:Rps6kb1 APN 11 86535410 critical splice donor site probably null
IGL03101:Rps6kb1 APN 11 86502882 missense probably benign 0.23
IGL03331:Rps6kb1 APN 11 86532830 missense probably damaging 1.00
R0025:Rps6kb1 UTSW 11 86511587 critical splice donor site probably null
R1797:Rps6kb1 UTSW 11 86502808 nonsense probably null
R1931:Rps6kb1 UTSW 11 86532821 missense possibly damaging 0.52
R2214:Rps6kb1 UTSW 11 86534070 missense possibly damaging 0.71
R3196:Rps6kb1 UTSW 11 86506807 missense probably benign 0.01
R3699:Rps6kb1 UTSW 11 86532794 missense probably damaging 1.00
R4171:Rps6kb1 UTSW 11 86544579 missense possibly damaging 0.68
R4685:Rps6kb1 UTSW 11 86519887 splice site probably null
R4727:Rps6kb1 UTSW 11 86544658 splice site probably null
R4728:Rps6kb1 UTSW 11 86544658 splice site probably null
R5450:Rps6kb1 UTSW 11 86532837 missense probably damaging 1.00
R5648:Rps6kb1 UTSW 11 86512871 missense possibly damaging 0.54
R5796:Rps6kb1 UTSW 11 86511851 missense probably benign 0.26
R5955:Rps6kb1 UTSW 11 86513605 missense probably damaging 1.00
R7080:Rps6kb1 UTSW 11 86506840 missense probably damaging 1.00
R7450:Rps6kb1 UTSW 11 86502831 missense probably benign 0.11
R7709:Rps6kb1 UTSW 11 86513322 missense probably damaging 1.00
R8084:Rps6kb1 UTSW 11 86535436 missense probably benign 0.00
R8366:Rps6kb1 UTSW 11 86511829 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTCAGTAAGCTTCCACATTTCG -3'
(R):5'- TCCTTTAGGCAATGATAGTGAGG -3'

Sequencing Primer
(F):5'- GTGGATTACAATAGATAACCCAGC -3'
(R):5'- GAATGCTAAGGACACGGCCC -3'
Posted On2015-06-20