Incidental Mutation 'R4291:Cfb'
ID323093
Institutional Source Beutler Lab
Gene Symbol Cfb
Ensembl Gene ENSMUSG00000090231
Gene Namecomplement factor B
SynonymsFB, Factor B, B, alternative-complement pathway C3/C5 convertase, Bf, H2-Bf
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34856374-34862518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34861138 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 122 (D122A)
Ref Sequence ENSEMBL: ENSMUSP00000120990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025229] [ENSMUST00000025230] [ENSMUST00000097343] [ENSMUST00000128767] [ENSMUST00000146299] [ENSMUST00000148431] [ENSMUST00000152417] [ENSMUST00000176203] [ENSMUST00000154526] [ENSMUST00000153400] [ENSMUST00000165953] [ENSMUST00000173357]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025229
AA Change: D124A

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025229
Gene: ENSMUSG00000090231
AA Change: D124A

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 751 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025230
SMART Domains Protein: ENSMUSP00000025230
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CCP 22 71 8e-24 BLAST
low complexity region 72 83 N/A INTRINSIC
CCP 94 149 1.34e-11 SMART
CCP 156 210 1.89e-11 SMART
Blast:VWA 219 245 1e-7 BLAST
VWA 259 464 1.32e-31 SMART
Tryp_SPc 468 747 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097343
SMART Domains Protein: ENSMUSP00000094956
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127795
Predicted Effect possibly damaging
Transcript: ENSMUST00000128767
AA Change: D122A

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119977
Gene: ENSMUSG00000090231
AA Change: D122A

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 749 2.53e-30 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129891
AA Change: D331A
SMART Domains Protein: ENSMUSP00000120864
Gene: ENSMUSG00000092511
AA Change: D331A

DomainStartEndE-ValueType
Blast:VWA 2 77 8e-7 BLAST
Tryp_SPc 85 365 5.69e-8 SMART
CCP 310 365 4.62e-15 SMART
CCP 372 425 2.06e-12 SMART
VWA 475 680 1.07e-40 SMART
Tryp_SPc 688 959 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133127
SMART Domains Protein: ENSMUSP00000118360
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
PDB:2WIN|L 2 43 2e-20 PDB
Blast:VWA 13 44 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000134300
SMART Domains Protein: ENSMUSP00000114241
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
Tryp_SPc 3 148 6.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141295
SMART Domains Protein: ENSMUSP00000118945
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 18 258 3.76e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146299
AA Change: D637A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511
AA Change: D637A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148431
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152417
SMART Domains Protein: ENSMUSP00000123536
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
CCP 19 73 1.89e-11 SMART
Blast:VWA 82 108 2e-7 BLAST
VWA 122 327 1.32e-31 SMART
Tryp_SPc 331 610 4.43e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176203
AA Change: D124A

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135660
Gene: ENSMUSG00000090231
AA Change: D124A

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 713 5.03e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154526
AA Change: D122A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120990
Gene: ENSMUSG00000090231
AA Change: D122A

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 711 5.03e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184774
Predicted Effect probably benign
Transcript: ENSMUST00000153400
SMART Domains Protein: ENSMUSP00000116497
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 1 217 2.36e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165953
SMART Domains Protein: ENSMUSP00000131195
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173357
SMART Domains Protein: ENSMUSP00000134272
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176332
Meta Mutation Damage Score 0.3938 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. This cluster includes several genes involved in regulation of the immune reaction. Polymorphisms in this gene are associated with a reduced risk of age-related macular degeneration. The polyadenylation site of this gene is 421 bp from the 5' end of the gene for complement component 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations lack the alternative complement pathway, and have reduced overall complement activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Cfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0270:Cfb UTSW 17 34860386 missense possibly damaging 0.92
R0419:Cfb UTSW 17 34858509 missense probably damaging 1.00
R0514:Cfb UTSW 17 34860898 missense probably damaging 1.00
R0645:Cfb UTSW 17 34860016 missense probably benign 0.25
R0668:Cfb UTSW 17 34857103 missense probably benign 0.29
R0893:Cfb UTSW 17 34858055 missense probably damaging 1.00
R1879:Cfb UTSW 17 34860560 missense probably benign 0.11
R2135:Cfb UTSW 17 34857278 missense possibly damaging 0.84
R3107:Cfb UTSW 17 34861824 missense possibly damaging 0.88
R4369:Cfb UTSW 17 34860314 missense probably damaging 1.00
R4371:Cfb UTSW 17 34860314 missense probably damaging 1.00
R4616:Cfb UTSW 17 34859068 missense probably benign 0.29
R5177:Cfb UTSW 17 34859026 missense probably damaging 1.00
R5689:Cfb UTSW 17 34861794 missense probably benign 0.00
R5773:Cfb UTSW 17 34857272 nonsense probably null
R6046:Cfb UTSW 17 34862102 splice site probably null
R6274:Cfb UTSW 17 34862093 missense probably benign 0.18
R6318:Cfb UTSW 17 34861824 missense possibly damaging 0.88
R7035:Cfb UTSW 17 34860031 missense possibly damaging 0.53
R7585:Cfb UTSW 17 34857761 missense probably benign 0.00
R7920:Cfb UTSW 17 34860891 missense probably benign 0.00
R8312:Cfb UTSW 17 34858145 missense probably benign 0.11
RF005:Cfb UTSW 17 34858046 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TAAGACAATTTGAGGGCCCATGC -3'
(R):5'- TAGTCCCATAACACAAGAGGCG -3'

Sequencing Primer
(F):5'- AATTTGAGGGCCCATGCATTCC -3'
(R):5'- TAGGGTTGAGGGGACTAGGC -3'
Posted On2015-06-20