Incidental Mutation 'R4291:Ttc27'
ID323094
Institutional Source Beutler Lab
Gene Symbol Ttc27
Ensembl Gene ENSMUSG00000024078
Gene Nametetratricopeptide repeat domain 27
Synonyms2610511O17Rik
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74717750-74863570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74856479 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 694 (L694P)
Ref Sequence ENSEMBL: ENSMUSP00000024882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024882]
Predicted Effect probably damaging
Transcript: ENSMUST00000024882
AA Change: L694P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024882
Gene: ENSMUSG00000024078
AA Change: L694P

DomainStartEndE-ValueType
TPR 531 564 7.34e-3 SMART
TPR 565 598 5.56e-3 SMART
TPR 599 632 3.81e-1 SMART
Blast:TPR 633 666 7e-15 BLAST
coiled coil region 817 847 N/A INTRINSIC
Meta Mutation Damage Score 0.9585 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Ttc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ttc27 APN 17 74780816 missense probably damaging 1.00
IGL01508:Ttc27 APN 17 74835357 missense probably damaging 0.98
IGL02010:Ttc27 APN 17 74780911 splice site probably benign
IGL02189:Ttc27 APN 17 74729899 missense probably damaging 0.99
IGL02487:Ttc27 APN 17 74856554 missense probably damaging 1.00
IGL02745:Ttc27 APN 17 74739733 missense probably benign 0.37
IGL02816:Ttc27 APN 17 74747774 splice site probably benign
IGL03389:Ttc27 APN 17 74858033 missense probably benign 0.00
R0024:Ttc27 UTSW 17 74770264 missense possibly damaging 0.79
R0511:Ttc27 UTSW 17 74718715 missense probably benign 0.22
R0518:Ttc27 UTSW 17 74856549 missense possibly damaging 0.80
R0521:Ttc27 UTSW 17 74856549 missense possibly damaging 0.80
R0633:Ttc27 UTSW 17 74729977 missense probably benign 0.02
R1415:Ttc27 UTSW 17 74739672 missense probably benign
R1597:Ttc27 UTSW 17 74863407 missense possibly damaging 0.95
R1961:Ttc27 UTSW 17 74780856 missense probably damaging 0.99
R2038:Ttc27 UTSW 17 74856502 missense probably benign 0.00
R3012:Ttc27 UTSW 17 74840459 missense probably benign 0.17
R3619:Ttc27 UTSW 17 74751128 splice site probably null
R4155:Ttc27 UTSW 17 74840460 missense probably benign 0.09
R4272:Ttc27 UTSW 17 74840360 missense probably damaging 1.00
R4557:Ttc27 UTSW 17 74829549 missense probably benign 0.00
R5068:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5069:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5070:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5074:Ttc27 UTSW 17 74747755 missense probably damaging 1.00
R5169:Ttc27 UTSW 17 74747695 nonsense probably null
R5203:Ttc27 UTSW 17 74777654 missense probably damaging 1.00
R5272:Ttc27 UTSW 17 74742977 missense probably damaging 1.00
R6260:Ttc27 UTSW 17 74858091 missense probably damaging 0.99
R6797:Ttc27 UTSW 17 74729888 missense probably benign 0.28
R6830:Ttc27 UTSW 17 74856555 nonsense probably null
R6987:Ttc27 UTSW 17 74777741 critical splice donor site probably null
R7121:Ttc27 UTSW 17 74747715 missense probably benign 0.04
R7393:Ttc27 UTSW 17 74770264 missense possibly damaging 0.79
R7543:Ttc27 UTSW 17 74717750 start gained probably benign
R7635:Ttc27 UTSW 17 74718715 missense probably benign 0.22
R8231:Ttc27 UTSW 17 74717964 missense probably benign 0.19
R8365:Ttc27 UTSW 17 74747674 missense probably damaging 1.00
X0026:Ttc27 UTSW 17 74856437 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GGTGGCTTGACGATTATTTCAC -3'
(R):5'- TCTTTACCTGTGGTAGCAAGGAC -3'

Sequencing Primer
(F):5'- TGATATCCAAGTAAGGCCACG -3'
(R):5'- CAGAGGCCCAGGACAGAC -3'
Posted On2015-06-20