Incidental Mutation 'R4292:Bivm'
ID323099
Institutional Source Beutler Lab
Gene Symbol Bivm
Ensembl Gene ENSMUSG00000041684
Gene Namebasic, immunoglobulin-like variable motif containing
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4292 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location44118957-44144770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44138633 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 364 (R364S)
Ref Sequence ENSEMBL: ENSMUSP00000110357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035991] [ENSMUST00000114709]
Predicted Effect probably damaging
Transcript: ENSMUST00000035991
AA Change: R364S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041964
Gene: ENSMUSG00000041684
AA Change: R364S

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114709
AA Change: R364S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110357
Gene: ENSMUSG00000041684
AA Change: R364S

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Meta Mutation Damage Score 0.4728 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 T C 6: 92,795,996 K1232E possibly damaging Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cep68 A T 11: 20,240,079 V311D probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gcn1l1 G A 5: 115,576,148 A116T possibly damaging Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Kif18a A T 2: 109,298,126 I376L probably damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Myh2 A G 11: 67,194,897 K1855R possibly damaging Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1450 G A 19: 12,954,156 C189Y possibly damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Pdss2 A G 10: 43,221,838 Y26C probably benign Het
Pgm2l1 A G 7: 100,250,301 T41A probably damaging Het
Prss58 T C 6: 40,897,310 D144G probably damaging Het
Rrp12 T C 19: 41,872,905 probably null Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Slco4c1 C G 1: 96,844,656 probably null Het
Srsf6 T C 2: 162,934,716 probably benign Het
Tgfb2 T C 1: 186,632,538 H253R probably damaging Het
Top3b A T 16: 16,883,519 I232F probably damaging Het
Trim24 G A 6: 37,900,692 R39H possibly damaging Het
Tsc22d1 T A 14: 76,418,880 M851K probably benign Het
Ttn A G 2: 76,932,511 V3268A possibly damaging Het
Unc79 A T 12: 103,183,444 Q2599L probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Other mutations in Bivm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Bivm APN 1 44129291 missense probably damaging 1.00
IGL01384:Bivm APN 1 44126747 missense possibly damaging 0.86
IGL01552:Bivm APN 1 44126773 missense probably benign 0.40
IGL01736:Bivm APN 1 44141813 missense probably damaging 1.00
IGL02332:Bivm APN 1 44128720 unclassified probably benign
IGL02704:Bivm APN 1 44126446 missense probably benign
IGL02859:Bivm APN 1 44136999 nonsense probably null
IGL02939:Bivm APN 1 44142960 missense probably benign 0.03
IGL03265:Bivm APN 1 44141845 missense probably damaging 1.00
R0456:Bivm UTSW 1 44126809 missense probably damaging 1.00
R1172:Bivm UTSW 1 44126782 missense probably benign 0.04
R1173:Bivm UTSW 1 44126782 missense probably benign 0.04
R1174:Bivm UTSW 1 44126782 missense probably benign 0.04
R1177:Bivm UTSW 1 44142963 missense probably benign 0.28
R1350:Bivm UTSW 1 44126703 missense possibly damaging 0.88
R1611:Bivm UTSW 1 44126747 missense possibly damaging 0.92
R2518:Bivm UTSW 1 44129615 missense probably damaging 0.96
R3735:Bivm UTSW 1 44126434 missense probably benign 0.07
R4290:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4293:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4294:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4849:Bivm UTSW 1 44142873 missense possibly damaging 0.70
R5204:Bivm UTSW 1 44138578 missense probably damaging 0.96
R5912:Bivm UTSW 1 44126413 nonsense probably null
R6045:Bivm UTSW 1 44119073 start gained probably benign
R6216:Bivm UTSW 1 44126868 critical splice donor site probably null
R6836:Bivm UTSW 1 44143136 missense possibly damaging 0.88
R7120:Bivm UTSW 1 44126446 missense probably benign
R7817:Bivm UTSW 1 44126401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGGATTCCTAGAATGGGACC -3'
(R):5'- GAACTTTCTGTGGCAAGACTGTAC -3'

Sequencing Primer
(F):5'- GGGACCAAACCTAAGTGCTCATATTG -3'
(R):5'- CTGTGGCAAGACTGTACATAGTAC -3'
Posted On2015-06-20