Incidental Mutation 'R4292:Lbr'
ID323102
Institutional Source Beutler Lab
Gene Symbol Lbr
Ensembl Gene ENSMUSG00000004880
Gene Namelamin B receptor
Synonyms
Accession Numbers

Genbank: NM_133815.2; Ensembl: ENSMUST00000005003

Is this an essential gene? Probably essential (E-score: 0.762) question?
Stock #R4292 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location181815335-181843046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 181820702 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 398 (C398Y)
Ref Sequence ENSEMBL: ENSMUSP00000005003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005003]
Predicted Effect probably damaging
Transcript: ENSMUST00000005003
AA Change: C398Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005003
Gene: ENSMUSG00000004880
AA Change: C398Y

DomainStartEndE-ValueType
TUDOR 4 62 6.7e-9 SMART
low complexity region 63 101 N/A INTRINSIC
low complexity region 111 121 N/A INTRINSIC
Pfam:ERG4_ERG24 194 626 4.6e-161 PFAM
Pfam:DUF1295 452 617 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194302
Predicted Effect unknown
Transcript: ENSMUST00000194415
AA Change: C156Y
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195808
Meta Mutation Damage Score 0.6941 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ERG4/ERG24 family. It localized in the nuclear envelope inner membrane and anchors the lamina and the heterochromatin to the membrane. It may mediate interaction between chromatin and lamin B. Mutations of this gene has been associated with autosomal recessive HEM/Greenberg skeletal dysplasia. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in abnormal skin and hair and impair growth. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(17) Spontaneous(6)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 T C 6: 92,795,996 K1232E possibly damaging Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cep68 A T 11: 20,240,079 V311D probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gcn1l1 G A 5: 115,576,148 A116T possibly damaging Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Kif18a A T 2: 109,298,126 I376L probably damaging Het
Myh2 A G 11: 67,194,897 K1855R possibly damaging Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1450 G A 19: 12,954,156 C189Y possibly damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Pdss2 A G 10: 43,221,838 Y26C probably benign Het
Pgm2l1 A G 7: 100,250,301 T41A probably damaging Het
Prss58 T C 6: 40,897,310 D144G probably damaging Het
Rrp12 T C 19: 41,872,905 probably null Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Slco4c1 C G 1: 96,844,656 probably null Het
Srsf6 T C 2: 162,934,716 probably benign Het
Tgfb2 T C 1: 186,632,538 H253R probably damaging Het
Top3b A T 16: 16,883,519 I232F probably damaging Het
Trim24 G A 6: 37,900,692 R39H possibly damaging Het
Tsc22d1 T A 14: 76,418,880 M851K probably benign Het
Ttn A G 2: 76,932,511 V3268A possibly damaging Het
Unc79 A T 12: 103,183,444 Q2599L probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Other mutations in Lbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Lbr APN 1 181825643 nonsense probably null
IGL01680:Lbr APN 1 181836194 missense probably damaging 1.00
IGL02738:Lbr APN 1 181832213 missense probably benign 0.16
IGL03048:Lbr APN 1 181838544 utr 5 prime probably benign
IGL03227:Lbr APN 1 181836055 unclassified probably null
IGL03337:Lbr APN 1 181832223 missense possibly damaging 0.92
Aconcagua UTSW 1 181828902 missense probably benign 0.02
kosciuszko UTSW 1 181825621 critical splice donor site probably null
Mont_blanc UTSW 1 181820702 missense probably damaging 1.00
seven UTSW 1 181832213 missense probably benign 0.16
1mM(1):Lbr UTSW 1 181831679 missense possibly damaging 0.65
H8562:Lbr UTSW 1 181820668 splice site probably benign
IGL02991:Lbr UTSW 1 181821552 missense probably damaging 1.00
R0597:Lbr UTSW 1 181832213 missense probably benign 0.16
R1118:Lbr UTSW 1 181820668 splice site probably benign
R1727:Lbr UTSW 1 181819916 missense probably benign 0.01
R2566:Lbr UTSW 1 181836127 missense probably damaging 0.96
R3699:Lbr UTSW 1 181818920 missense probably damaging 1.00
R3854:Lbr UTSW 1 181831715 missense probably benign 0.05
R4290:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4293:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4294:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4295:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4771:Lbr UTSW 1 181838421 missense probably damaging 1.00
R4890:Lbr UTSW 1 181817568 missense probably benign 0.10
R5011:Lbr UTSW 1 181819888 nonsense probably null
R5402:Lbr UTSW 1 181819961 missense probably benign 0.00
R5486:Lbr UTSW 1 181818838 critical splice donor site probably null
R5617:Lbr UTSW 1 181828902 missense probably benign 0.02
R5630:Lbr UTSW 1 181816964 unclassified probably null
R6360:Lbr UTSW 1 181832155 missense probably benign 0.00
R6575:Lbr UTSW 1 181836198 missense probably damaging 1.00
R7069:Lbr UTSW 1 181828789 missense probably damaging 1.00
R7342:Lbr UTSW 1 181825621 critical splice donor site probably null
R7590:Lbr UTSW 1 181821511 missense probably damaging 1.00
R7686:Lbr UTSW 1 181817521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGCCTGAAACTGGGTC -3'
(R):5'- GCTCTCAAGATCAGTAGCGG -3'

Sequencing Primer
(F):5'- CTGGGTCAAATAAGGCTTTACTTTCC -3'
(R):5'- TCAAGATCAGTAGCGGCCCTG -3'
Posted On2015-06-20