Incidental Mutation 'R4293:Rev1'
ID323143
Institutional Source Beutler Lab
Gene Symbol Rev1
Ensembl Gene ENSMUSG00000026082
Gene NameREV1, DNA directed polymerase
SynonymsREV1, Rev1l, 1110027I23Rik
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location38052786-38129801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38108419 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 13 (D13E)
Ref Sequence ENSEMBL: ENSMUSP00000141379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000192594] [ENSMUST00000193697] [ENSMUST00000195383]
Predicted Effect probably benign
Transcript: ENSMUST00000027251
AA Change: D13E

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082
AA Change: D13E

DomainStartEndE-ValueType
BRCT 46 121 3.99e-13 SMART
low complexity region 320 342 N/A INTRINSIC
Pfam:IMS 420 620 1.9e-43 PFAM
Pfam:IMS_C 700 831 5.8e-20 PFAM
low complexity region 888 901 N/A INTRINSIC
Pfam:DUF4414 938 1071 9.7e-11 PFAM
Pfam:REV1_C 1127 1248 1.2e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192594
AA Change: D13E

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141379
Gene: ENSMUSG00000026082
AA Change: D13E

DomainStartEndE-ValueType
BRCT 46 121 2.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193697
AA Change: D13E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141560
Gene: ENSMUSG00000026082
AA Change: D13E

DomainStartEndE-ValueType
Pfam:BRCT 45 97 2.1e-4 PFAM
Pfam:PTCB-BRCT 52 96 1.3e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000195383
AA Change: D13E

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the S. cerevisiae mutagenesis protein Rev1. The Rev1 proteins contain a BRCT domain, which is important in protein-protein interactions. A suggested role for the human Rev1-like protein is as a scaffold that recruits DNA polymerases involved in translesion synthesis (TLS) of damaged DNA. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal somatic hypermutation frequency of the Ig gene. Mice homozygous for a knock-out allele exhibit background-sensitive prenatal lethality and abnormal somatic hypermutation frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Rev1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Rev1 APN 1 38098940 missense probably damaging 1.00
IGL01065:Rev1 APN 1 38099009 missense possibly damaging 0.89
IGL01393:Rev1 APN 1 38092063 missense probably damaging 1.00
IGL03003:Rev1 APN 1 38088073 missense possibly damaging 0.77
H8562:Rev1 UTSW 1 38056767 missense probably damaging 0.96
PIT1430001:Rev1 UTSW 1 38056256 unclassified probably benign
R0409:Rev1 UTSW 1 38074368 nonsense probably null
R0606:Rev1 UTSW 1 38059123 missense probably null 1.00
R1134:Rev1 UTSW 1 38057687 missense probably benign 0.04
R1171:Rev1 UTSW 1 38088500 missense possibly damaging 0.89
R1208:Rev1 UTSW 1 38059118 unclassified probably benign
R1440:Rev1 UTSW 1 38088205 missense probably damaging 1.00
R1485:Rev1 UTSW 1 38088572 missense probably benign 0.00
R1627:Rev1 UTSW 1 38055490 missense probably damaging 0.99
R3845:Rev1 UTSW 1 38098988 missense probably damaging 0.99
R3948:Rev1 UTSW 1 38074333 missense possibly damaging 0.69
R4074:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4075:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4076:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4248:Rev1 UTSW 1 38107648 missense possibly damaging 0.87
R4548:Rev1 UTSW 1 38059194 missense possibly damaging 0.72
R4610:Rev1 UTSW 1 38053649 missense probably damaging 1.00
R4654:Rev1 UTSW 1 38079256 intron probably benign
R5032:Rev1 UTSW 1 38074489 intron probably benign
R5286:Rev1 UTSW 1 38055326 nonsense probably null
R5311:Rev1 UTSW 1 38079393 missense probably benign 0.00
R5327:Rev1 UTSW 1 38108451 nonsense probably null
R6363:Rev1 UTSW 1 38071489 missense probably damaging 1.00
R7050:Rev1 UTSW 1 38054271 missense probably damaging 1.00
R7072:Rev1 UTSW 1 38067545 nonsense probably null
R7132:Rev1 UTSW 1 38071449 missense possibly damaging 0.95
R7264:Rev1 UTSW 1 38085601 missense probably damaging 1.00
R7298:Rev1 UTSW 1 38053104 missense probably damaging 1.00
R7367:Rev1 UTSW 1 38074407 nonsense probably null
R7395:Rev1 UTSW 1 38088065 missense possibly damaging 0.69
R7829:Rev1 UTSW 1 38056445 missense probably damaging 0.98
R8053:Rev1 UTSW 1 38063141 missense possibly damaging 0.67
R8093:Rev1 UTSW 1 38075016 intron probably benign
X0017:Rev1 UTSW 1 38053661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCAGTGTTGTGCTACAC -3'
(R):5'- ACTTGGCATTGAACTTTGGTC -3'

Sequencing Primer
(F):5'- GTGTTGTGCTACACAGAAGACTAAC -3'
(R):5'- CTGTGTTCATTGAATGTTGAATTCTC -3'
Posted On2015-06-20