Incidental Mutation 'R4293:Bivm'
ID323144
Institutional Source Beutler Lab
Gene Symbol Bivm
Ensembl Gene ENSMUSG00000041684
Gene Namebasic, immunoglobulin-like variable motif containing
Synonyms
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location44118957-44144770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44138633 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 364 (R364S)
Ref Sequence ENSEMBL: ENSMUSP00000110357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035991] [ENSMUST00000114709]
Predicted Effect probably damaging
Transcript: ENSMUST00000035991
AA Change: R364S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041964
Gene: ENSMUSG00000041684
AA Change: R364S

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114709
AA Change: R364S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110357
Gene: ENSMUSG00000041684
AA Change: R364S

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Meta Mutation Damage Score 0.4728 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Bivm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Bivm APN 1 44129291 missense probably damaging 1.00
IGL01384:Bivm APN 1 44126747 missense possibly damaging 0.86
IGL01552:Bivm APN 1 44126773 missense probably benign 0.40
IGL01736:Bivm APN 1 44141813 missense probably damaging 1.00
IGL02332:Bivm APN 1 44128720 unclassified probably benign
IGL02704:Bivm APN 1 44126446 missense probably benign
IGL02859:Bivm APN 1 44136999 nonsense probably null
IGL02939:Bivm APN 1 44142960 missense probably benign 0.03
IGL03265:Bivm APN 1 44141845 missense probably damaging 1.00
R0456:Bivm UTSW 1 44126809 missense probably damaging 1.00
R1172:Bivm UTSW 1 44126782 missense probably benign 0.04
R1173:Bivm UTSW 1 44126782 missense probably benign 0.04
R1174:Bivm UTSW 1 44126782 missense probably benign 0.04
R1177:Bivm UTSW 1 44142963 missense probably benign 0.28
R1350:Bivm UTSW 1 44126703 missense possibly damaging 0.88
R1611:Bivm UTSW 1 44126747 missense possibly damaging 0.92
R2518:Bivm UTSW 1 44129615 missense probably damaging 0.96
R3735:Bivm UTSW 1 44126434 missense probably benign 0.07
R4290:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4292:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4294:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4849:Bivm UTSW 1 44142873 missense possibly damaging 0.70
R5204:Bivm UTSW 1 44138578 missense probably damaging 0.96
R5912:Bivm UTSW 1 44126413 nonsense probably null
R6045:Bivm UTSW 1 44119073 start gained probably benign
R6216:Bivm UTSW 1 44126868 critical splice donor site probably null
R6836:Bivm UTSW 1 44143136 missense possibly damaging 0.88
R7120:Bivm UTSW 1 44126446 missense probably benign
R7817:Bivm UTSW 1 44126401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCAAGGATTCCTAGAATGGGACC -3'
(R):5'- AACTTTCTGTGGCAAGACTGTAC -3'

Sequencing Primer
(F):5'- GGGACCAAACCTAAGTGCTCATATTG -3'
(R):5'- CTGTGGCAAGACTGTACATAGTAC -3'
Posted On2015-06-20