Incidental Mutation 'R4293:Tmem237'
ID323145
Institutional Source Beutler Lab
Gene Symbol Tmem237
Ensembl Gene ENSMUSG00000038079
Gene Nametransmembrane protein 237
SynonymsAls2cr4, LOC381259
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location59100590-59120408 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 59119836 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066374] [ENSMUST00000078874] [ENSMUST00000087475] [ENSMUST00000094917] [ENSMUST00000114275] [ENSMUST00000186395] [ENSMUST00000186477] [ENSMUST00000186794] [ENSMUST00000190014] [ENSMUST00000191200]
Predicted Effect probably benign
Transcript: ENSMUST00000066374
SMART Domains Protein: ENSMUSP00000070711
Gene: ENSMUSG00000079550

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078874
SMART Domains Protein: ENSMUSP00000077914
Gene: ENSMUSG00000079550

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 348 362 N/A INTRINSIC
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087475
SMART Domains Protein: ENSMUSP00000084745
Gene: ENSMUSG00000038079

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:TMEM237 134 382 4.4e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094917
SMART Domains Protein: ENSMUSP00000092522
Gene: ENSMUSG00000038079

DomainStartEndE-ValueType
Pfam:TMEM237 148 391 3.4e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114275
SMART Domains Protein: ENSMUSP00000109914
Gene: ENSMUSG00000079550

DomainStartEndE-ValueType
L27 46 101 4.02e-9 SMART
L27 105 158 2.49e-14 SMART
PDZ 180 253 3.57e-11 SMART
SH3 263 329 2.94e-5 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
GuKc 444 637 1.21e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180570
Predicted Effect probably benign
Transcript: ENSMUST00000186395
Predicted Effect probably benign
Transcript: ENSMUST00000186477
SMART Domains Protein: ENSMUSP00000140352
Gene: ENSMUSG00000079550

DomainStartEndE-ValueType
L27 27 82 1.3e-11 SMART
L27 86 139 8.6e-17 SMART
PDZ 161 234 1.8e-13 SMART
SH3 222 297 5.1e-4 SMART
low complexity region 353 362 N/A INTRINSIC
GuKc 381 574 5.8e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186794
SMART Domains Protein: ENSMUSP00000139823
Gene: ENSMUSG00000038079

DomainStartEndE-ValueType
Pfam:TMEM237 158 406 5.2e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189096
Predicted Effect probably benign
Transcript: ENSMUST00000190014
SMART Domains Protein: ENSMUSP00000140134
Gene: ENSMUSG00000038079

DomainStartEndE-ValueType
Pfam:TMEM237 129 230 9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191200
SMART Domains Protein: ENSMUSP00000140957
Gene: ENSMUSG00000079550

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 342 356 N/A INTRINSIC
low complexity region 391 400 N/A INTRINSIC
GuKc 419 612 1.21e-50 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetraspanin protein that is thought to be involved in WNT signaling. Defects in this gene are a cause of Joubert syndrome-14. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Tmem237
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Tmem237 APN 1 59107453 critical splice donor site probably null
IGL02184:Tmem237 APN 1 59120111 utr 5 prime probably null
IGL03156:Tmem237 APN 1 59109127 missense probably damaging 1.00
R0308:Tmem237 UTSW 1 59107517 missense probably damaging 1.00
R0659:Tmem237 UTSW 1 59114094 missense possibly damaging 0.62
R0981:Tmem237 UTSW 1 59118005 missense probably damaging 1.00
R2032:Tmem237 UTSW 1 59109106 missense probably benign 0.01
R2061:Tmem237 UTSW 1 59120286 unclassified probably benign
R2245:Tmem237 UTSW 1 59108704 missense probably damaging 1.00
R4290:Tmem237 UTSW 1 59119836 unclassified probably benign
R4294:Tmem237 UTSW 1 59119836 unclassified probably benign
R6793:Tmem237 UTSW 1 59114216 missense probably benign 0.01
R7062:Tmem237 UTSW 1 59119612 intron probably null
R7632:Tmem237 UTSW 1 59116901 missense probably benign 0.00
Z1176:Tmem237 UTSW 1 59115927 missense probably damaging 1.00
Z1176:Tmem237 UTSW 1 59115929 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GGCGGAGACTAAATTCCCAAC -3'
(R):5'- CCGGTGGGGAGTTTGAATAC -3'

Sequencing Primer
(F):5'- CAGCTCAAAAGTACCTGAGGCTC -3'
(R):5'- TTGAATACGAGTCTGGTCCCGC -3'
Posted On2015-06-20