Incidental Mutation 'R4293:Xpr1'
ID323147
Institutional Source Beutler Lab
Gene Symbol Xpr1
Ensembl Gene ENSMUSG00000026469
Gene Namexenotropic and polytropic retrovirus receptor 1
SynonymsRmc1, suppressor of yeast G deletion, Syg1, Rmc-1
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location155275701-155417415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155312796 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 366 (F366S)
Ref Sequence ENSEMBL: ENSMUSP00000107404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027741] [ENSMUST00000111774] [ENSMUST00000111775]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027741
AA Change: F366S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027741
Gene: ENSMUSG00000026469
AA Change: F366S

DomainStartEndE-ValueType
Pfam:SPX 1 174 1.4e-33 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 268 616 5.8e-96 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111774
AA Change: F366S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107404
Gene: ENSMUSG00000026469
AA Change: F366S

DomainStartEndE-ValueType
Pfam:SPX 1 176 1.5e-38 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 267 617 2.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111775
AA Change: F366S

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107405
Gene: ENSMUSG00000026469
AA Change: F366S

DomainStartEndE-ValueType
Pfam:SPX 1 176 4.5e-39 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 267 434 3.6e-45 PFAM
Pfam:EXS 432 552 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175545
Meta Mutation Damage Score 0.4435 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for the xenotropic and polytropic classes of murine leukemia viruses. The encoded protein is involved in phosphate homeostasis by mediating phosphate export from the cell. Defects in this gene have been associated with idiopathic basal ganglia calcification-6. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygotes and heterozygotes for a variant from some wild Mus stocks, including M. spretus, support replication of xenotropic murine leukemia viruses and mink cell focus-forming murine leukemia viruses that are not replicated in most laboratory strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Xpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Xpr1 APN 1 155290234 missense probably benign 0.00
IGL02657:Xpr1 APN 1 155290280 missense probably benign 0.05
IGL03077:Xpr1 APN 1 155281028 missense possibly damaging 0.58
R0019:Xpr1 UTSW 1 155332399 splice site probably benign
R0350:Xpr1 UTSW 1 155330468 missense probably damaging 1.00
R1299:Xpr1 UTSW 1 155417203 missense probably damaging 0.99
R1855:Xpr1 UTSW 1 155283256 missense probably benign
R2008:Xpr1 UTSW 1 155281029 unclassified probably null
R2071:Xpr1 UTSW 1 155290280 missense probably benign 0.05
R4509:Xpr1 UTSW 1 155290161 intron probably benign
R5060:Xpr1 UTSW 1 155328684 critical splice acceptor site probably null
R5527:Xpr1 UTSW 1 155290235 missense probably benign
R5586:Xpr1 UTSW 1 155312863 missense probably benign
R5860:Xpr1 UTSW 1 155332122 intron probably benign
R7565:Xpr1 UTSW 1 155307742 missense probably benign
R7729:Xpr1 UTSW 1 155312872 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATCCATCAGAAGCACCTGC -3'
(R):5'- CATCTCCCATTTGAGGATTGTTGG -3'

Sequencing Primer
(F):5'- CTCCTGAAGCTGGGACCACTC -3'
(R):5'- CCCATTTGAGGATTGTTGGATTGTTC -3'
Posted On2015-06-20