Incidental Mutation 'R4293:Mettl18'
ID323148
Institutional Source Beutler Lab
Gene Symbol Mettl18
Ensembl Gene ENSMUSG00000041396
Gene Namemethyltransferase like 18
Synonyms
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location163994889-163997243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163996602 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 164 (D164G)
Ref Sequence ENSEMBL: ENSMUSP00000107116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045694] [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000111490] [ENSMUST00000160926]
Predicted Effect probably damaging
Transcript: ENSMUST00000045694
AA Change: D164G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048636
Gene: ENSMUSG00000041396
AA Change: D164G

DomainStartEndE-ValueType
Pfam:Methyltransf_16 150 233 7.3e-7 PFAM
Pfam:PrmA 166 240 2.1e-7 PFAM
low complexity region 300 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045876
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097493
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111490
AA Change: D164G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107116
Gene: ENSMUSG00000041396
AA Change: D164G

DomainStartEndE-ValueType
Pfam:MTS 147 232 4.5e-6 PFAM
Pfam:Methyltransf_16 149 233 3.6e-7 PFAM
Pfam:PrmA 166 238 2.7e-7 PFAM
low complexity region 300 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160926
SMART Domains Protein: ENSMUSP00000124826
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162949
Meta Mutation Damage Score 0.7098 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Mettl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Mettl18 APN 1 163996226 missense possibly damaging 0.83
IGL01989:Mettl18 APN 1 163996303 missense probably benign 0.00
R0190:Mettl18 UTSW 1 163996422 missense probably damaging 0.98
R0394:Mettl18 UTSW 1 163996341 missense probably benign
R0562:Mettl18 UTSW 1 163996493 missense probably benign 0.04
R2260:Mettl18 UTSW 1 163996825 missense probably benign 0.28
R4626:Mettl18 UTSW 1 163996476 missense probably damaging 1.00
R4749:Mettl18 UTSW 1 163996785 missense probably benign 0.13
R5930:Mettl18 UTSW 1 163997177 missense probably null 0.00
R5987:Mettl18 UTSW 1 163996775 missense probably benign 0.04
R6503:Mettl18 UTSW 1 163997118 missense possibly damaging 0.94
R6687:Mettl18 UTSW 1 163996800 missense possibly damaging 0.73
R6730:Mettl18 UTSW 1 163997181 missense probably damaging 1.00
R7457:Mettl18 UTSW 1 163996761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCCTAAAGATGTGAATCACG -3'
(R):5'- GCTGTCATCTTGCAAAGGGAC -3'

Sequencing Primer
(F):5'- GTGAATCACGTCTTAGAAAATACGG -3'
(R):5'- GCTGTCATCTTGCAAAGGGACATTAG -3'
Posted On2015-06-20