Incidental Mutation 'R4293:Lbr'
ID323149
Institutional Source Beutler Lab
Gene Symbol Lbr
Ensembl Gene ENSMUSG00000004880
Gene Namelamin B receptor
Synonyms
MMRRC Submission 041082-MU
Accession Numbers

Genbank: NM_133815.2; Ensembl: ENSMUST00000005003

Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location181815335-181843046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 181820702 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 398 (C398Y)
Ref Sequence ENSEMBL: ENSMUSP00000005003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005003]
Predicted Effect probably damaging
Transcript: ENSMUST00000005003
AA Change: C398Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005003
Gene: ENSMUSG00000004880
AA Change: C398Y

DomainStartEndE-ValueType
TUDOR 4 62 6.7e-9 SMART
low complexity region 63 101 N/A INTRINSIC
low complexity region 111 121 N/A INTRINSIC
Pfam:ERG4_ERG24 194 626 4.6e-161 PFAM
Pfam:DUF1295 452 617 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194302
Predicted Effect unknown
Transcript: ENSMUST00000194415
AA Change: C156Y
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195808
Meta Mutation Damage Score 0.6941 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ERG4/ERG24 family. It localized in the nuclear envelope inner membrane and anchors the lamina and the heterochromatin to the membrane. It may mediate interaction between chromatin and lamin B. Mutations of this gene has been associated with autosomal recessive HEM/Greenberg skeletal dysplasia. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in abnormal skin and hair and impair growth. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(17) Spontaneous(6)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Lbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Lbr APN 1 181825643 nonsense probably null
IGL01680:Lbr APN 1 181836194 missense probably damaging 1.00
IGL02738:Lbr APN 1 181832213 missense probably benign 0.16
IGL03048:Lbr APN 1 181838544 utr 5 prime probably benign
IGL03227:Lbr APN 1 181836055 unclassified probably null
IGL03337:Lbr APN 1 181832223 missense possibly damaging 0.92
Aconcagua UTSW 1 181828902 missense probably benign 0.02
kosciuszko UTSW 1 181825621 critical splice donor site probably null
Mont_blanc UTSW 1 181820702 missense probably damaging 1.00
seven UTSW 1 181832213 missense probably benign 0.16
thredbo UTSW 1 181817521 missense probably damaging 1.00
1mM(1):Lbr UTSW 1 181831679 missense possibly damaging 0.65
H8562:Lbr UTSW 1 181820668 splice site probably benign
IGL02991:Lbr UTSW 1 181821552 missense probably damaging 1.00
R0597:Lbr UTSW 1 181832213 missense probably benign 0.16
R1118:Lbr UTSW 1 181820668 splice site probably benign
R1727:Lbr UTSW 1 181819916 missense probably benign 0.01
R2566:Lbr UTSW 1 181836127 missense probably damaging 0.96
R3699:Lbr UTSW 1 181818920 missense probably damaging 1.00
R3854:Lbr UTSW 1 181831715 missense probably benign 0.05
R4290:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4292:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4294:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4295:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4771:Lbr UTSW 1 181838421 missense probably damaging 1.00
R4890:Lbr UTSW 1 181817568 missense probably benign 0.10
R5011:Lbr UTSW 1 181819888 nonsense probably null
R5402:Lbr UTSW 1 181819961 missense probably benign 0.00
R5486:Lbr UTSW 1 181818838 critical splice donor site probably null
R5617:Lbr UTSW 1 181828902 missense probably benign 0.02
R5630:Lbr UTSW 1 181816964 unclassified probably null
R6360:Lbr UTSW 1 181832155 missense probably benign 0.00
R6575:Lbr UTSW 1 181836198 missense probably damaging 1.00
R7069:Lbr UTSW 1 181828789 missense probably damaging 1.00
R7342:Lbr UTSW 1 181825621 critical splice donor site probably null
R7590:Lbr UTSW 1 181821511 missense probably damaging 1.00
R7686:Lbr UTSW 1 181817521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAAACTGGGTCAAATAAGGC -3'
(R):5'- CTCTCAAGATCAGTAGCGGC -3'

Sequencing Primer
(F):5'- CTGGGTCAAATAAGGCTTTACTTTCC -3'
(R):5'- AAGATCAGTAGCGGCCCTGG -3'
Posted On2015-06-20