Incidental Mutation 'R4293:Fnbp1'
ID323152
Institutional Source Beutler Lab
Gene Symbol Fnbp1
Ensembl Gene ENSMUSG00000075415
Gene Nameformin binding protein 1
Synonyms2210010H06Rik, FBP17, FBP1, 1110057E06Rik
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31026206-31142008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31105350 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 24 (F24S)
Ref Sequence ENSEMBL: ENSMUSP00000121282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073879] [ENSMUST00000075326] [ENSMUST00000100207] [ENSMUST00000100208] [ENSMUST00000113552] [ENSMUST00000113555] [ENSMUST00000113560] [ENSMUST00000113562] [ENSMUST00000113564] [ENSMUST00000136181] [ENSMUST00000149196]
Predicted Effect probably damaging
Transcript: ENSMUST00000073879
AA Change: F11S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109188
Gene: ENSMUSG00000075415
AA Change: F11S

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075326
AA Change: F11S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074796
Gene: ENSMUSG00000075415
AA Change: F11S

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 360 451 1e-26 PDB
low complexity region 503 512 N/A INTRINSIC
SH3 518 575 3.2e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100207
AA Change: F11S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097781
Gene: ENSMUSG00000075415
AA Change: F11S

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 338 424 1e-26 PDB
low complexity region 476 485 N/A INTRINSIC
SH3 491 548 3.2e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100208
AA Change: F11S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097782
Gene: ENSMUSG00000075415
AA Change: F11S

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 394 480 2e-26 PDB
low complexity region 532 541 N/A INTRINSIC
SH3 547 604 3.2e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113552
AA Change: F11S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109181
Gene: ENSMUSG00000075415
AA Change: F11S

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113555
AA Change: F11S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109184
Gene: ENSMUSG00000075415
AA Change: F11S

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 370 456 1e-26 PDB
low complexity region 508 517 N/A INTRINSIC
SH3 523 580 3.2e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113560
AA Change: F11S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109190
Gene: ENSMUSG00000075415
AA Change: F11S

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 399 485 2e-26 PDB
low complexity region 537 546 N/A INTRINSIC
SH3 552 609 3.2e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113562
AA Change: F11S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109192
Gene: ENSMUSG00000075415
AA Change: F11S

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113564
AA Change: F11S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109194
Gene: ENSMUSG00000075415
AA Change: F11S

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 472 481 N/A INTRINSIC
SH3 487 544 3.2e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000128500
AA Change: F1S
SMART Domains Protein: ENSMUSP00000115013
Gene: ENSMUSG00000075415
AA Change: F1S

DomainStartEndE-ValueType
Pfam:FCH 1 80 7.7e-20 PFAM
PDB:2KE4|A 167 253 2e-27 PDB
low complexity region 305 314 N/A INTRINSIC
SH3 320 377 3.2e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136085
Predicted Effect probably damaging
Transcript: ENSMUST00000136181
AA Change: F11S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120580
Gene: ENSMUSG00000075415
AA Change: F11S

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 116 125 N/A INTRINSIC
PDB:2EFL|A 126 160 1e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000149196
AA Change: F24S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121282
Gene: ENSMUSG00000075415
AA Change: F24S

DomainStartEndE-ValueType
FCH 14 107 8.88e-17 SMART
low complexity region 185 194 N/A INTRINSIC
Meta Mutation Damage Score 0.8928 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the formin-binding-protein family. The protein contains an N-terminal Fer/Cdc42-interacting protein 4 (CIP4) homology (FCH) domain followed by a coiled-coil domain, a proline-rich motif, a second coiled-coil domain, a Rho family protein-binding domain (RBD), and a C-terminal SH3 domain. This protein binds sorting nexin 2 (SNX2), tankyrase (TNKS), and dynamin; an interaction between this protein and formin has not been demonstrated yet in human. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Fnbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Fnbp1 APN 2 31083042 missense probably damaging 1.00
IGL01640:Fnbp1 APN 2 31105291 missense probably damaging 1.00
R0381:Fnbp1 UTSW 2 31033029 missense probably benign 0.02
R0573:Fnbp1 UTSW 2 31058978 missense probably damaging 1.00
R0713:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
R1120:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
R1364:Fnbp1 UTSW 2 31059031 splice site probably benign
R1974:Fnbp1 UTSW 2 31053047 missense probably null 0.94
R3800:Fnbp1 UTSW 2 31033131 missense probably damaging 1.00
R4176:Fnbp1 UTSW 2 31036119 splice site probably null
R4478:Fnbp1 UTSW 2 31105254 missense probably damaging 1.00
R4602:Fnbp1 UTSW 2 31036540 critical splice donor site probably null
R4716:Fnbp1 UTSW 2 31055520 missense probably benign 0.03
R5909:Fnbp1 UTSW 2 31048199 splice site probably null
R6436:Fnbp1 UTSW 2 31096127 missense probably damaging 1.00
R7075:Fnbp1 UTSW 2 31058914 missense probably benign
R7747:Fnbp1 UTSW 2 31036147 missense probably damaging 0.99
R8069:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
Z1177:Fnbp1 UTSW 2 31083059 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGAAATCATGCTTGCTTGCTTC -3'
(R):5'- GTTGATGTAAAGCTCTCAACAGAC -3'

Sequencing Primer
(F):5'- GATGATCTGAGTTCAATCCCCAGG -3'
(R):5'- TGTAAAGCTCTCAACAGACACCCC -3'
Posted On2015-06-20