Incidental Mutation 'R4293:Srsf6'
ID323155
Institutional Source Beutler Lab
Gene Symbol Srsf6
Ensembl Gene ENSMUSG00000016921
Gene Nameserine/arginine-rich splicing factor 6
SynonymsSfrs6, 1210001E11Rik
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location162931528-162937121 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 162934716 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017065] [ENSMUST00000126163] [ENSMUST00000130411]
Predicted Effect probably benign
Transcript: ENSMUST00000017065
SMART Domains Protein: ENSMUSP00000142183
Gene: ENSMUSG00000016921

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126163
SMART Domains Protein: ENSMUSP00000141349
Gene: ENSMUSG00000016921

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130411
AA Change: S327P
SMART Domains Protein: ENSMUSP00000119065
Gene: ENSMUSG00000016921
AA Change: S327P

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
low complexity region 74 100 N/A INTRINSIC
RRM 111 179 6.97e-14 SMART
low complexity region 184 280 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 313 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193611
Meta Mutation Damage Score 0.2356 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Srsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Srsf6 APN 2 162931707 missense probably damaging 1.00
IGL01960:Srsf6 APN 2 162933754 missense probably damaging 1.00
R1292:Srsf6 UTSW 2 162934483 unclassified probably benign
R1789:Srsf6 UTSW 2 162934488 unclassified probably benign
R1936:Srsf6 UTSW 2 162934483 unclassified probably benign
R1937:Srsf6 UTSW 2 162934483 unclassified probably benign
R1939:Srsf6 UTSW 2 162934483 unclassified probably benign
R1940:Srsf6 UTSW 2 162934483 unclassified probably benign
R2225:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R2226:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R2227:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R4026:Srsf6 UTSW 2 162934291 unclassified probably benign
R4290:Srsf6 UTSW 2 162934716 unclassified probably benign
R4292:Srsf6 UTSW 2 162934716 unclassified probably benign
R4294:Srsf6 UTSW 2 162934716 unclassified probably benign
R4295:Srsf6 UTSW 2 162934716 unclassified probably benign
R4592:Srsf6 UTSW 2 162931723 missense probably damaging 0.99
R4613:Srsf6 UTSW 2 162933709 missense probably benign 0.45
R4657:Srsf6 UTSW 2 162933427 missense probably benign 0.01
R7378:Srsf6 UTSW 2 162934569 missense unknown
R7446:Srsf6 UTSW 2 162934716 missense unknown
R7578:Srsf6 UTSW 2 162932862 missense probably benign 0.00
R7730:Srsf6 UTSW 2 162931723 missense probably damaging 0.99
R7908:Srsf6 UTSW 2 162933840 missense unknown
X0020:Srsf6 UTSW 2 162933498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCACGTAGTAGGTCACGG -3'
(R):5'- AAGGGAGAGGGCTTCATACCAC -3'

Sequencing Primer
(F):5'- ACGTAGTAGGTCACGGTCTCG -3'
(R):5'- GAGAGGGCTTCATACCACCATTTTAG -3'
Posted On2015-06-20