Incidental Mutation 'R4293:Atpaf1'
ID323161
Institutional Source Beutler Lab
Gene Symbol Atpaf1
Ensembl Gene ENSMUSG00000028710
Gene NameATP synthase mitochondrial F1 complex assembly factor 1
Synonyms6330547J17Rik, ATP11p, ATP11
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115784812-115818828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115788359 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 142 (M142L)
Ref Sequence ENSEMBL: ENSMUSP00000135831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175725] [ENSMUST00000176047] [ENSMUST00000176192] [ENSMUST00000177280]
Predicted Effect probably benign
Transcript: ENSMUST00000175725
AA Change: M1L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135073
Gene: ENSMUSG00000028710
AA Change: M1L

DomainStartEndE-ValueType
Pfam:ATP11 1 189 2.5e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176047
AA Change: M142L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135831
Gene: ENSMUSG00000028710
AA Change: M142L

DomainStartEndE-ValueType
low complexity region 9 39 N/A INTRINSIC
Pfam:ATP11 91 329 2.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176192
Predicted Effect probably benign
Transcript: ENSMUST00000177280
AA Change: M142L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135214
Gene: ENSMUSG00000028710
AA Change: M142L

DomainStartEndE-ValueType
low complexity region 9 39 N/A INTRINSIC
Pfam:ATP11 89 212 7.3e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000184179
AA Change: M64L
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an assembly factor for the F(1) component of the mitochondrial ATP synthase. This protein binds specifically to the F1 beta subunit and is thought to prevent this subunit from forming nonproductive homooligomers during enzyme assembly. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Atpaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02529:Atpaf1 APN 4 115791269 missense probably damaging 1.00
IGL03122:Atpaf1 APN 4 115791278 missense probably damaging 1.00
R0396:Atpaf1 UTSW 4 115785252 missense possibly damaging 0.58
R0924:Atpaf1 UTSW 4 115795438 missense probably damaging 1.00
R1462:Atpaf1 UTSW 4 115784953 unclassified probably benign
R1614:Atpaf1 UTSW 4 115796757 missense possibly damaging 0.52
R1637:Atpaf1 UTSW 4 115788302 missense probably benign 0.00
R2180:Atpaf1 UTSW 4 115788360 start codon destroyed probably null 0.03
R4290:Atpaf1 UTSW 4 115788359 missense probably benign 0.02
R7291:Atpaf1 UTSW 4 115811091 missense probably damaging 1.00
R7423:Atpaf1 UTSW 4 115790630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGTCCCTTCTCTGAGGAG -3'
(R):5'- CCATGAGCTCCTTGACCACTAG -3'

Sequencing Primer
(F):5'- CCTTCTCTGAGGAGGTGCG -3'
(R):5'- AGACTACATTTCTTATGAGTGGGGAC -3'
Posted On2015-06-20