Incidental Mutation 'R4293:Bms1'
ID323164
Institutional Source Beutler Lab
Gene Symbol Bms1
Ensembl Gene ENSMUSG00000030138
Gene NameBMS1, ribosome biogenesis factor
SynonymsBms1l
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location118383381-118419474 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 118405347 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032237] [ENSMUST00000032237]
Predicted Effect probably null
Transcript: ENSMUST00000032237
SMART Domains Protein: ENSMUSP00000032237
Gene: ENSMUSG00000030138

DomainStartEndE-ValueType
SCOP:d1f5na2 78 187 2e-5 SMART
low complexity region 190 205 N/A INTRINSIC
AARP2CN 231 317 2.15e-42 SMART
low complexity region 436 460 N/A INTRINSIC
low complexity region 462 481 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
low complexity region 518 537 N/A INTRINSIC
low complexity region 590 613 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
Blast:AAA 663 740 9e-20 BLAST
DUF663 816 1108 6.7e-173 SMART
coiled coil region 1223 1257 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000032237
SMART Domains Protein: ENSMUSP00000032237
Gene: ENSMUSG00000030138

DomainStartEndE-ValueType
SCOP:d1f5na2 78 187 2e-5 SMART
low complexity region 190 205 N/A INTRINSIC
AARP2CN 231 317 2.15e-42 SMART
low complexity region 436 460 N/A INTRINSIC
low complexity region 462 481 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
low complexity region 518 537 N/A INTRINSIC
low complexity region 590 613 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
Blast:AAA 663 740 9e-20 BLAST
DUF663 816 1108 6.7e-173 SMART
coiled coil region 1223 1257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205207
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a ribosome assembly protein. A similar protein in yeast functions in 35S-rRNA processing, which includes a series of cleavage steps critical for formation of 40S ribosomes. Related pseudogenes exist on chromosomes 2, 9, 10, 15, 16, and 22.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Bms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bms1 APN 6 118404583 missense probably benign 0.01
IGL00763:Bms1 APN 6 118418402 splice site probably benign
IGL00839:Bms1 APN 6 118405291 missense probably benign 0.30
IGL02005:Bms1 APN 6 118404585 missense probably damaging 1.00
IGL02271:Bms1 APN 6 118389329 missense probably benign 0.10
IGL02403:Bms1 APN 6 118405224 missense possibly damaging 0.89
IGL02474:Bms1 APN 6 118416519 missense probably benign 0.00
IGL03230:Bms1 APN 6 118418561 missense possibly damaging 0.88
IGL03277:Bms1 APN 6 118405122 missense probably benign
PIT4508001:Bms1 UTSW 6 118383806 missense probably benign 0.03
R0028:Bms1 UTSW 6 118416519 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0276:Bms1 UTSW 6 118408134 missense possibly damaging 0.87
R0295:Bms1 UTSW 6 118389337 missense probably benign 0.04
R0360:Bms1 UTSW 6 118405290 missense probably benign 0.13
R0556:Bms1 UTSW 6 118413179 missense probably damaging 1.00
R1078:Bms1 UTSW 6 118405221 missense probably benign 0.00
R1583:Bms1 UTSW 6 118389389 splice site probably benign
R1815:Bms1 UTSW 6 118383781 missense probably damaging 1.00
R1957:Bms1 UTSW 6 118392978 missense probably damaging 0.98
R2045:Bms1 UTSW 6 118392627 missense probably damaging 1.00
R2511:Bms1 UTSW 6 118391153 splice site probably null
R4296:Bms1 UTSW 6 118404999 missense probably damaging 0.96
R4467:Bms1 UTSW 6 118383847 missense probably damaging 0.99
R4688:Bms1 UTSW 6 118392706 missense probably damaging 1.00
R4718:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R5015:Bms1 UTSW 6 118404263 nonsense probably null
R5327:Bms1 UTSW 6 118405218 missense possibly damaging 0.53
R5489:Bms1 UTSW 6 118413745 missense possibly damaging 0.64
R5511:Bms1 UTSW 6 118388887 missense possibly damaging 0.85
R5636:Bms1 UTSW 6 118388825 missense probably benign 0.00
R5815:Bms1 UTSW 6 118404279 missense probably damaging 1.00
R6245:Bms1 UTSW 6 118396836 missense probably damaging 0.96
R6299:Bms1 UTSW 6 118418515 missense probably damaging 0.98
R6389:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R6838:Bms1 UTSW 6 118416494 missense probably benign 0.00
R7129:Bms1 UTSW 6 118403161 nonsense probably null
R7414:Bms1 UTSW 6 118383745 missense possibly damaging 0.93
R7811:Bms1 UTSW 6 118403138 missense probably damaging 0.99
R7883:Bms1 UTSW 6 118388774 missense probably benign 0.04
R7966:Bms1 UTSW 6 118388774 missense probably benign 0.04
R8046:Bms1 UTSW 6 118408144 missense probably benign
R8068:Bms1 UTSW 6 118413750 missense probably damaging 1.00
R8098:Bms1 UTSW 6 118384258 missense probably damaging 0.98
X0067:Bms1 UTSW 6 118404834 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCATCACTAGAGCCAGGTTCC -3'
(R):5'- TTCTACCAGGAAACTCTGATTCC -3'

Sequencing Primer
(F):5'- TAGAGCCAGGTTCCATCCC -3'
(R):5'- GAAACTCTGATTCCAGTCCTTTTCAG -3'
Posted On2015-06-20