Incidental Mutation 'R4293:Stk32c'
ID323167
Institutional Source Beutler Lab
Gene Symbol Stk32c
Ensembl Gene ENSMUSG00000015981
Gene Nameserine/threonine kinase 32C
SynonymsYANK3, Pkek
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139103638-139213307 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 139120788 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000165870]
Predicted Effect probably null
Transcript: ENSMUST00000016125
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165870
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. It is thought that this family member is functional in brain due to its high expression levels there. DNA methylation differences have been found in this gene in monozygotic twins that are discordant for adolescent depression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Stk32c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Stk32c APN 7 139188153 missense possibly damaging 0.47
IGL02559:Stk32c APN 7 139120690 missense probably benign 0.00
IGL02805:Stk32c APN 7 139121846 missense probably damaging 1.00
R0531:Stk32c UTSW 7 139120720 missense probably damaging 0.97
R0622:Stk32c UTSW 7 139188110 missense probably benign 0.00
R1140:Stk32c UTSW 7 139125179 missense probably damaging 0.99
R1473:Stk32c UTSW 7 139125179 missense probably damaging 0.99
R1589:Stk32c UTSW 7 139119015 critical splice donor site probably null
R1697:Stk32c UTSW 7 139121824 missense probably benign 0.25
R1855:Stk32c UTSW 7 139121447 missense probably damaging 0.97
R4290:Stk32c UTSW 7 139120788 critical splice acceptor site probably null
R4295:Stk32c UTSW 7 139120788 critical splice acceptor site probably null
R5323:Stk32c UTSW 7 139119360 missense probably benign 0.07
R5854:Stk32c UTSW 7 139188279 intron probably benign
R5907:Stk32c UTSW 7 139120674 missense probably benign 0.32
R6115:Stk32c UTSW 7 139120712 nonsense probably null
R6117:Stk32c UTSW 7 139122923 nonsense probably null
R6176:Stk32c UTSW 7 139120775 missense probably benign 0.02
R6460:Stk32c UTSW 7 139105274 missense probably damaging 1.00
R6695:Stk32c UTSW 7 139122964 missense probably damaging 1.00
R6745:Stk32c UTSW 7 139122893 missense probably damaging 0.99
R7177:Stk32c UTSW 7 139104302 missense possibly damaging 0.62
R7676:Stk32c UTSW 7 139105304 missense possibly damaging 0.87
R7721:Stk32c UTSW 7 139188153 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GCTAGTGAAGGAGTCTGAGC -3'
(R):5'- AGCTTCTGGCCTCTGATACC -3'

Sequencing Primer
(F):5'- CCATGGAAAGATGGGGTGTCTCC -3'
(R):5'- TCTGATACCCAGTTCAGTCGGG -3'
Posted On2015-06-20