Incidental Mutation 'R4293:Olfr926'
ID323171
Institutional Source Beutler Lab
Gene Symbol Olfr926
Ensembl Gene ENSMUSG00000064333
Gene Nameolfactory receptor 926
SynonymsGA_x6K02T2PVTD-32573036-32573962, MOR171-8
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38877126-38878176 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38877313 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 46 (I46V)
Ref Sequence ENSEMBL: ENSMUSP00000077405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078289]
Predicted Effect probably damaging
Transcript: ENSMUST00000078289
AA Change: I46V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077405
Gene: ENSMUSG00000064333
AA Change: I46V

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 2.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 32 282 8.6e-7 PFAM
Pfam:7tm_1 38 287 1.6e-20 PFAM
Meta Mutation Damage Score 0.2203 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Olfr926
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Olfr926 APN 9 38877548 missense probably damaging 0.97
IGL02315:Olfr926 APN 9 38878057 missense probably damaging 1.00
IGL02626:Olfr926 APN 9 38877488 missense probably benign 0.05
IGL03001:Olfr926 APN 9 38878078 missense probably benign
IGL03085:Olfr926 APN 9 38877663 missense probably benign
R0365:Olfr926 UTSW 9 38877185 missense probably benign 0.00
R0600:Olfr926 UTSW 9 38877815 missense probably damaging 0.99
R0708:Olfr926 UTSW 9 38877275 missense probably damaging 0.97
R1178:Olfr926 UTSW 9 38877755 missense probably damaging 1.00
R1762:Olfr926 UTSW 9 38877785 missense probably damaging 0.98
R1856:Olfr926 UTSW 9 38877596 missense possibly damaging 0.58
R1924:Olfr926 UTSW 9 38877851 missense probably damaging 1.00
R2267:Olfr926 UTSW 9 38878063 missense probably benign 0.00
R3729:Olfr926 UTSW 9 38877251 missense probably damaging 1.00
R4290:Olfr926 UTSW 9 38877313 missense probably damaging 1.00
R4292:Olfr926 UTSW 9 38877313 missense probably damaging 1.00
R4295:Olfr926 UTSW 9 38877313 missense probably damaging 1.00
R4973:Olfr926 UTSW 9 38878104 makesense probably null
R5026:Olfr926 UTSW 9 38877899 missense possibly damaging 0.95
R5086:Olfr926 UTSW 9 38877791 missense probably damaging 1.00
R5103:Olfr926 UTSW 9 38877576 missense probably damaging 1.00
R5817:Olfr926 UTSW 9 38877377 missense probably damaging 1.00
R5998:Olfr926 UTSW 9 38877869 missense probably damaging 0.99
R6101:Olfr926 UTSW 9 38877308 missense possibly damaging 0.95
R6105:Olfr926 UTSW 9 38877308 missense possibly damaging 0.95
R6176:Olfr926 UTSW 9 38877377 missense probably damaging 1.00
R6403:Olfr926 UTSW 9 38877242 missense probably damaging 0.97
R8116:Olfr926 UTSW 9 38877730 missense probably damaging 0.98
R8144:Olfr926 UTSW 9 38877366 missense probably damaging 1.00
RF014:Olfr926 UTSW 9 38877900 missense probably benign 0.14
X0022:Olfr926 UTSW 9 38877656 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TGAATCCATCAATCACGATTCCAAG -3'
(R):5'- TCATAGGCCATGGCTGTCAG -3'

Sequencing Primer
(F):5'- AAAATAACCATTGCCCTCCCTTTTC -3'
(R):5'- GCAGGTAGCCTTCTGAAATAGC -3'
Posted On2015-06-20