Incidental Mutation 'R4293:Arid3b'
ID323172
Institutional Source Beutler Lab
Gene Symbol Arid3b
Ensembl Gene ENSMUSG00000004661
Gene NameAT rich interactive domain 3B (BRIGHT-like)
SynonymsBdp, Dri2
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57790353-57836793 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 57790430 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004780] [ENSMUST00000098686] [ENSMUST00000114165] [ENSMUST00000164010] [ENSMUST00000164035] [ENSMUST00000171444] [ENSMUST00000171949]
Predicted Effect probably benign
Transcript: ENSMUST00000004780
SMART Domains Protein: ENSMUSP00000004780
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 528 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098686
SMART Domains Protein: ENSMUSP00000096283
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114165
SMART Domains Protein: ENSMUSP00000109802
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164010
SMART Domains Protein: ENSMUSP00000126889
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
SCOP:d1c20a_ 174 240 6e-9 SMART
PDB:4LJX|B 204 238 4e-9 PDB
Blast:ARID 210 231 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164035
SMART Domains Protein: ENSMUSP00000131677
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
SCOP:d1c20a_ 174 233 2e-8 SMART
PDB:4LJX|B 204 268 1e-10 PDB
Blast:ARID 210 267 3e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170133
Predicted Effect probably benign
Transcript: ENSMUST00000171444
SMART Domains Protein: ENSMUSP00000130173
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 528 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171949
SMART Domains Protein: ENSMUSP00000127525
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 54 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARID (AT-rich interaction domain) family of DNA-binding proteins. The encoded protein is homologous with two proteins that bind to the retinoblastoma gene product, and also with the mouse Bright and Drosophila dead ringer proteins. A pseudogene on chromosome 1p31 exists for this gene. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die before E11.5 displaying variable phenotypes associated with impaired generation of cranial-mesenchymal cells in the first and second branchial arches. Common defects include a wavy neural tube, small branchial arches, and a defective cardiovascular system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Arid3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Arid3b APN 9 57833924 missense possibly damaging 0.92
IGL01394:Arid3b APN 9 57795034 missense probably damaging 1.00
IGL01950:Arid3b APN 9 57794974 missense probably damaging 1.00
R0970:Arid3b UTSW 9 57833551 intron probably benign
R1848:Arid3b UTSW 9 57796677 nonsense probably null
R1940:Arid3b UTSW 9 57796148 missense possibly damaging 0.86
R4290:Arid3b UTSW 9 57790430 unclassified probably benign
R4424:Arid3b UTSW 9 57833868 missense probably benign 0.22
R4449:Arid3b UTSW 9 57798121 nonsense probably null
R5353:Arid3b UTSW 9 57795037 splice site probably null
R5544:Arid3b UTSW 9 57798097 nonsense probably null
R6828:Arid3b UTSW 9 57810163 critical splice donor site probably null
R7168:Arid3b UTSW 9 57805535 missense probably benign 0.00
R7254:Arid3b UTSW 9 57796754 missense probably damaging 0.99
R7398:Arid3b UTSW 9 57796212 missense probably benign 0.01
R7882:Arid3b UTSW 9 57796497 missense possibly damaging 0.85
R7891:Arid3b UTSW 9 57810159 missense probably benign 0.00
R7965:Arid3b UTSW 9 57796497 missense possibly damaging 0.85
R7974:Arid3b UTSW 9 57810159 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATTCTGACAACACGGCTGAG -3'
(R):5'- AAATGCAAGAGCTGGGTGCC -3'

Sequencing Primer
(F):5'- ACGGAGTTCCAGCCCTCTG -3'
(R):5'- GTGATAGCACATGGTAGC -3'
Posted On2015-06-20