Incidental Mutation 'R4293:Olfr1378'
ID323176
Institutional Source Beutler Lab
Gene Symbol Olfr1378
Ensembl Gene ENSMUSG00000050343
Gene Nameolfactory receptor 1378
SynonymsGA_x6K02T2QP88-4469162-4468215, MOR129-2
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50966530-50973113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50969426 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 136 (M136T)
Ref Sequence ENSEMBL: ENSMUSP00000149432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052285] [ENSMUST00000213259]
Predicted Effect probably damaging
Transcript: ENSMUST00000052285
AA Change: M136T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058119
Gene: ENSMUSG00000050343
AA Change: M136T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.1e-54 PFAM
Pfam:7tm_1 41 289 1.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213259
AA Change: M136T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.4262 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Olfr1378
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Olfr1378 APN 11 50969119 missense probably benign 0.00
PIT4243001:Olfr1378 UTSW 11 50969552 missense probably damaging 1.00
R0540:Olfr1378 UTSW 11 50969843 missense possibly damaging 0.96
R0607:Olfr1378 UTSW 11 50969843 missense possibly damaging 0.96
R0699:Olfr1378 UTSW 11 50969818 missense probably damaging 1.00
R0719:Olfr1378 UTSW 11 50969934 nonsense probably null
R2117:Olfr1378 UTSW 11 50969320 missense probably damaging 0.98
R2263:Olfr1378 UTSW 11 50969869 missense possibly damaging 0.75
R3402:Olfr1378 UTSW 11 50969068 missense probably benign
R3767:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R3768:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R3769:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R4409:Olfr1378 UTSW 11 50969396 missense probably damaging 1.00
R4446:Olfr1378 UTSW 11 50969863 missense probably damaging 1.00
R4731:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R4732:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R4733:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R5437:Olfr1378 UTSW 11 50969108 missense probably benign 0.02
R6085:Olfr1378 UTSW 11 50969123 missense probably damaging 1.00
R6648:Olfr1378 UTSW 11 50969173 missense probably damaging 1.00
R7419:Olfr1378 UTSW 11 50969325 nonsense probably null
R7686:Olfr1378 UTSW 11 50969755 missense possibly damaging 0.92
X0011:Olfr1378 UTSW 11 50969654 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCAAGGCTCTGGTGAACTAC -3'
(R):5'- ATGCATGTGAACGGTGTGATAG -3'

Sequencing Primer
(F):5'- CATGTTGGGAATCAAGACCATCTC -3'
(R):5'- TGTGATAGAGGTCAGCCCAC -3'
Posted On2015-06-20