Incidental Mutation 'R4293:Slfn10-ps'
ID323179
Institutional Source Beutler Lab
Gene Symbol Slfn10-ps
Ensembl Gene ENSMUSG00000072621
Gene Nameschlafen 10, pseudogene
Synonyms
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83028130-83040042 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 83035434 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100716
SMART Domains Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

DomainStartEndE-ValueType
Pfam:AlbA_2 142 278 1.3e-13 PFAM
Pfam:DUF2075 529 697 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152760
SMART Domains Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

DomainStartEndE-ValueType
Pfam:AAA_4 142 280 1.8e-14 PFAM
Pfam:DUF2075 529 693 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215473
Meta Mutation Damage Score 0.3175 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Slfn10-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slfn10-ps APN 11 83035529 unclassified noncoding transcript
IGL00826:Slfn10-ps APN 11 83035259 unclassified noncoding transcript
IGL01022:Slfn10-ps APN 11 83035527 unclassified noncoding transcript
IGL01409:Slfn10-ps APN 11 83035496 unclassified noncoding transcript
IGL01664:Slfn10-ps APN 11 83035935 unclassified noncoding transcript
IGL01700:Slfn10-ps APN 11 83029112 unclassified noncoding transcript
IGL02093:Slfn10-ps APN 11 83032190 unclassified noncoding transcript
IGL02253:Slfn10-ps APN 11 83029064 unclassified noncoding transcript
IGL02364:Slfn10-ps APN 11 83032291 unclassified noncoding transcript
IGL02466:Slfn10-ps APN 11 83030264 unclassified noncoding transcript
IGL02636:Slfn10-ps APN 11 83030145 unclassified noncoding transcript
R0055:Slfn10-ps UTSW 11 83030300 unclassified noncoding transcript
R0055:Slfn10-ps UTSW 11 83030300 unclassified noncoding transcript
R0069:Slfn10-ps UTSW 11 83035542 unclassified noncoding transcript
R0069:Slfn10-ps UTSW 11 83035542 unclassified noncoding transcript
R0164:Slfn10-ps UTSW 11 83035302 unclassified noncoding transcript
R0362:Slfn10-ps UTSW 11 83035774 unclassified noncoding transcript
R0382:Slfn10-ps UTSW 11 83029534 unclassified noncoding transcript
R0597:Slfn10-ps UTSW 11 83035653 unclassified noncoding transcript
R0812:Slfn10-ps UTSW 11 83035562 unclassified noncoding transcript
R0904:Slfn10-ps UTSW 11 83035409 unclassified noncoding transcript
R1552:Slfn10-ps UTSW 11 83029850 unclassified noncoding transcript
R1703:Slfn10-ps UTSW 11 83030043 unclassified noncoding transcript
R2127:Slfn10-ps UTSW 11 83030342 unclassified noncoding transcript
R2151:Slfn10-ps UTSW 11 83035685 unclassified noncoding transcript
R2302:Slfn10-ps UTSW 11 83028930 unclassified noncoding transcript
R3114:Slfn10-ps UTSW 11 83029129 unclassified noncoding transcript
R4929:Slfn10-ps UTSW 11 83029519 unclassified noncoding transcript
R4970:Slfn10-ps UTSW 11 83030381 unclassified noncoding transcript
R5083:Slfn10-ps UTSW 11 83030515 unclassified noncoding transcript
R5290:Slfn10-ps UTSW 11 83029025 unclassified noncoding transcript
R5306:Slfn10-ps UTSW 11 83035529 unclassified noncoding transcript
R5444:Slfn10-ps UTSW 11 83035287 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- GGCTCTACTTTGATCACACAGAG -3'
(R):5'- AGGAGCCATGTATCAGAACAGC -3'

Sequencing Primer
(F):5'- TCTACTTTGATCACACAGAGATAACC -3'
(R):5'- CAGCCTTGAAACAAATCCAGCTTTTG -3'
Posted On2015-06-20