Incidental Mutation 'R4293:Spata13'
ID323183
Institutional Source Beutler Lab
Gene Symbol Spata13
Ensembl Gene ENSMUSG00000021990
Gene Namespermatogenesis associated 13
SynonymsESTM11
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location60634001-60764556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60709555 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 684 (M684K)
Ref Sequence ENSEMBL: ENSMUSP00000123928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022566] [ENSMUST00000160973]
Predicted Effect probably damaging
Transcript: ENSMUST00000022566
AA Change: M684K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022566
Gene: ENSMUSG00000021990
AA Change: M684K

DomainStartEndE-ValueType
low complexity region 307 320 N/A INTRINSIC
low complexity region 354 370 N/A INTRINSIC
low complexity region 426 450 N/A INTRINSIC
low complexity region 453 462 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 571 584 N/A INTRINSIC
low complexity region 604 623 N/A INTRINSIC
SH3 742 797 4.92e-16 SMART
RhoGEF 836 1015 1.22e-58 SMART
PH 1048 1155 1.16e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159476
Predicted Effect unknown
Transcript: ENSMUST00000160095
AA Change: M235K
SMART Domains Protein: ENSMUSP00000123744
Gene: ENSMUSG00000021990
AA Change: M235K

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 100 124 N/A INTRINSIC
low complexity region 127 136 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160973
AA Change: M684K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123928
Gene: ENSMUSG00000021990
AA Change: M684K

DomainStartEndE-ValueType
low complexity region 307 320 N/A INTRINSIC
low complexity region 354 370 N/A INTRINSIC
low complexity region 426 450 N/A INTRINSIC
low complexity region 453 462 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 571 584 N/A INTRINSIC
low complexity region 604 623 N/A INTRINSIC
SH3 742 797 4.92e-16 SMART
RhoGEF 836 1015 1.22e-58 SMART
PH 1048 1155 1.16e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162131
AA Change: M149K
SMART Domains Protein: ENSMUSP00000124586
Gene: ENSMUSG00000021990
AA Change: M149K

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
SH3 208 263 4.92e-16 SMART
Blast:RhoGEF 302 340 7e-19 BLAST
Meta Mutation Damage Score 0.0770 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal but show a significant reduction in the number and size of intestinal adenomas in conjunction with ApcMin heterozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Spata13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Spata13 APN 14 60691274 missense probably damaging 1.00
IGL02455:Spata13 APN 14 60706714 missense probably benign 0.01
IGL03189:Spata13 APN 14 60691614 missense possibly damaging 0.71
IGL03235:Spata13 APN 14 60751792 missense probably damaging 1.00
PIT4378001:Spata13 UTSW 14 60749996 missense probably damaging 1.00
R0278:Spata13 UTSW 14 60692088 missense probably benign 0.02
R0316:Spata13 UTSW 14 60692339 missense probably benign
R0458:Spata13 UTSW 14 60692043 missense probably damaging 0.98
R1546:Spata13 UTSW 14 60756408 missense probably damaging 1.00
R1780:Spata13 UTSW 14 60691725 missense probably damaging 0.96
R1791:Spata13 UTSW 14 60709459 missense probably damaging 1.00
R1970:Spata13 UTSW 14 60691463 missense probably damaging 0.99
R2059:Spata13 UTSW 14 60759591 missense possibly damaging 0.79
R2063:Spata13 UTSW 14 60760871 critical splice acceptor site probably benign
R2068:Spata13 UTSW 14 60760871 critical splice acceptor site probably benign
R2212:Spata13 UTSW 14 60706723 missense probably benign 0.00
R2327:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R3414:Spata13 UTSW 14 60706723 missense probably benign 0.00
R4115:Spata13 UTSW 14 60692478 missense probably damaging 1.00
R4276:Spata13 UTSW 14 60756296 missense probably damaging 1.00
R4289:Spata13 UTSW 14 60691074 missense probably damaging 1.00
R4291:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4294:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4295:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4779:Spata13 UTSW 14 60753907 nonsense probably null
R4780:Spata13 UTSW 14 60753907 nonsense probably null
R4838:Spata13 UTSW 14 60733179 missense probably benign 0.17
R4997:Spata13 UTSW 14 60709459 missense probably damaging 1.00
R5066:Spata13 UTSW 14 60750089 missense possibly damaging 0.78
R5399:Spata13 UTSW 14 60747541 missense probably benign 0.00
R5685:Spata13 UTSW 14 60691203 missense probably benign 0.00
R5708:Spata13 UTSW 14 60692003 missense probably damaging 1.00
R5747:Spata13 UTSW 14 60747503 missense probably benign 0.00
R6073:Spata13 UTSW 14 60750021 missense probably damaging 1.00
R6135:Spata13 UTSW 14 60756428 missense probably damaging 0.98
R6233:Spata13 UTSW 14 60692007 missense probably benign 0.06
R6782:Spata13 UTSW 14 60691463 missense probably damaging 0.99
R6873:Spata13 UTSW 14 60691957 missense probably benign
R6958:Spata13 UTSW 14 60751851 missense possibly damaging 0.94
R7105:Spata13 UTSW 14 60753870 missense probably damaging 0.97
R7286:Spata13 UTSW 14 60756422 missense probably damaging 1.00
R7512:Spata13 UTSW 14 60751777 missense probably damaging 1.00
R7565:Spata13 UTSW 14 60751849 missense probably damaging 1.00
R7608:Spata13 UTSW 14 60692507 missense possibly damaging 0.50
R7743:Spata13 UTSW 14 60756249 missense probably damaging 0.99
R7795:Spata13 UTSW 14 60691842 missense possibly damaging 0.92
R8073:Spata13 UTSW 14 60691256 missense probably damaging 1.00
R8304:Spata13 UTSW 14 60756508 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CAGAACTGTTTTGTGGCTCGC -3'
(R):5'- TTTACCCTGGCATGGCTCTG -3'

Sequencing Primer
(F):5'- TCGCAGGAGCTGAGACTTC -3'
(R):5'- GCTCTGCAGCAACTCAAGAG -3'
Posted On2015-06-20