Incidental Mutation 'R4293:Kcnv1'
ID323185
Institutional Source Beutler Lab
Gene Symbol Kcnv1
Ensembl Gene ENSMUSG00000022342
Gene Namepotassium channel, subfamily V, member 1
Synonyms2700023A03Rik
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location45106284-45114920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45114444 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 66 (T66M)
Ref Sequence ENSEMBL: ENSMUSP00000022967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022967]
Predicted Effect probably damaging
Transcript: ENSMUST00000022967
AA Change: T66M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022967
Gene: ENSMUSG00000022342
AA Change: T66M

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
BTB 42 160 1.17e-12 SMART
Pfam:Ion_trans 212 440 8.9e-45 PFAM
Pfam:Ion_trans_2 350 436 3.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228536
Meta Mutation Damage Score 0.9059 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This protein is essentially present in the brain, and its role might be to inhibit the function of a particular class of outward rectifier potassium channel types. [provided by RefSeq, Jul 2008]
PHENOTYPE: At weaning, homozygous mutant mice exhibit tetany, tremors and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Kcnv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Kcnv1 APN 15 45113228 missense probably benign 0.00
IGL02227:Kcnv1 APN 15 45114274 missense probably damaging 1.00
IGL02472:Kcnv1 APN 15 45109123 nonsense probably null
IGL03239:Kcnv1 APN 15 45109490 splice site probably benign
R0079:Kcnv1 UTSW 15 45113333 missense probably damaging 1.00
R0534:Kcnv1 UTSW 15 45109249 missense probably damaging 0.98
R0627:Kcnv1 UTSW 15 45112881 splice site probably benign
R1614:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R1615:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R2942:Kcnv1 UTSW 15 45109185 missense probably damaging 1.00
R4244:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4290:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4291:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4294:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4295:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4335:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4342:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4345:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4354:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4934:Kcnv1 UTSW 15 45109248 missense probably damaging 1.00
R5240:Kcnv1 UTSW 15 45113244 missense probably damaging 1.00
R5295:Kcnv1 UTSW 15 45114591 missense unknown
R5631:Kcnv1 UTSW 15 45109357 missense probably damaging 1.00
R5669:Kcnv1 UTSW 15 45114252 missense possibly damaging 0.71
R5762:Kcnv1 UTSW 15 45109122 missense probably damaging 0.99
R5776:Kcnv1 UTSW 15 45114567 missense unknown
R5787:Kcnv1 UTSW 15 45114330 missense probably damaging 1.00
R5980:Kcnv1 UTSW 15 45109414 missense probably damaging 0.99
R6819:Kcnv1 UTSW 15 45109117 missense probably damaging 0.99
R6851:Kcnv1 UTSW 15 45109198 missense probably damaging 1.00
R6997:Kcnv1 UTSW 15 45114601 missense unknown
R7254:Kcnv1 UTSW 15 45113208 missense probably benign 0.00
R7258:Kcnv1 UTSW 15 45109315 missense probably damaging 0.99
R7272:Kcnv1 UTSW 15 45113180 missense probably benign 0.00
R7367:Kcnv1 UTSW 15 45109242 missense probably damaging 1.00
R7995:Kcnv1 UTSW 15 45109347 missense probably damaging 1.00
X0026:Kcnv1 UTSW 15 45109467 missense possibly damaging 0.69
Z1177:Kcnv1 UTSW 15 45114435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTGCTCCATGACATG -3'
(R):5'- GGTCAGGATGGATCTGTCAC -3'

Sequencing Primer
(F):5'- TCCATGACATGCAGGCGAC -3'
(R):5'- TGGATCTGTCACCCCGCAAC -3'
Posted On2015-06-20