Incidental Mutation 'R4293:C330027C09Rik'
ID323186
Institutional Source Beutler Lab
Gene Symbol C330027C09Rik
Ensembl Gene ENSMUSG00000033031
Gene NameRIKEN cDNA C330027C09 gene
SynonymsCip2a
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location48994185-49019709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49013249 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 571 (F571Y)
Ref Sequence ENSEMBL: ENSMUSP00000113075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048374] [ENSMUST00000117994]
Predicted Effect probably benign
Transcript: ENSMUST00000048374
AA Change: F571Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044714
Gene: ENSMUSG00000033031
AA Change: F571Y

DomainStartEndE-ValueType
SCOP:d1jdha_ 47 309 3e-4 SMART
low complexity region 439 450 N/A INTRINSIC
coiled coil region 635 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117994
AA Change: F571Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113075
Gene: ENSMUSG00000033031
AA Change: F571Y

DomainStartEndE-ValueType
SCOP:d1jdha_ 47 309 2e-4 SMART
low complexity region 439 450 N/A INTRINSIC
coiled coil region 635 887 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149004
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele display oligozoospermia, small epididymis and impaired spermatogonial progenitor cell maintenance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in C330027C09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C330027C09Rik APN 16 49001815 missense probably damaging 1.00
IGL00788:C330027C09Rik APN 16 49009069 splice site probably benign
IGL01343:C330027C09Rik APN 16 49013188 missense probably damaging 1.00
IGL01348:C330027C09Rik APN 16 49013188 missense probably damaging 1.00
IGL01876:C330027C09Rik APN 16 49001678 missense probably damaging 1.00
IGL02255:C330027C09Rik APN 16 49010813 missense probably damaging 0.99
IGL02515:C330027C09Rik APN 16 49005733 missense possibly damaging 0.47
IGL03295:C330027C09Rik APN 16 48994341 missense probably damaging 1.00
R0020:C330027C09Rik UTSW 16 49001612 missense probably damaging 1.00
R0020:C330027C09Rik UTSW 16 49001612 missense probably damaging 1.00
R0031:C330027C09Rik UTSW 16 49017373 missense probably benign 0.14
R0612:C330027C09Rik UTSW 16 48999039 missense probably benign 0.04
R1187:C330027C09Rik UTSW 16 49000293 missense probably damaging 1.00
R1707:C330027C09Rik UTSW 16 49018404 missense probably damaging 1.00
R1711:C330027C09Rik UTSW 16 49017486 missense probably benign 0.31
R1715:C330027C09Rik UTSW 16 49005719 missense probably benign 0.18
R2000:C330027C09Rik UTSW 16 49014969 missense probably damaging 0.99
R2002:C330027C09Rik UTSW 16 49005851 splice site probably benign
R2360:C330027C09Rik UTSW 16 49017465 nonsense probably null
R4093:C330027C09Rik UTSW 16 49000976 splice site probably benign
R4292:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4295:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4726:C330027C09Rik UTSW 16 49014070 missense probably benign 0.02
R4925:C330027C09Rik UTSW 16 49016363 critical splice donor site probably null
R5735:C330027C09Rik UTSW 16 49017493 critical splice donor site probably null
R5893:C330027C09Rik UTSW 16 48997500 missense probably benign
R6146:C330027C09Rik UTSW 16 48994329 nonsense probably null
R6649:C330027C09Rik UTSW 16 49017466 missense probably damaging 1.00
R7235:C330027C09Rik UTSW 16 49001059 missense probably damaging 1.00
R7300:C330027C09Rik UTSW 16 49013854 missense probably damaging 1.00
R7325:C330027C09Rik UTSW 16 49005821 missense probably benign 0.32
R7365:C330027C09Rik UTSW 16 49001653 missense probably benign 0.35
R7414:C330027C09Rik UTSW 16 49001635 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGTAAGTAGAAAAGAGCTCTCTGG -3'
(R):5'- GTATTCCTGTGGGCAGACAG -3'

Sequencing Primer
(F):5'- GCTCTCTGGAAAATTGAGAATGTTTC -3'
(R):5'- CAACGCAGGAGCATTATC -3'
Posted On2015-06-20