Incidental Mutation 'R4293:Lmf1'
ID323189
Institutional Source Beutler Lab
Gene Symbol Lmf1
Ensembl Gene ENSMUSG00000002279
Gene Namelipase maturation factor 1
SynonymsTmem112, 2400010G15Rik
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4293 (G1)
Quality Score209
Status Validated
Chromosome17
Chromosomal Location25579174-25662826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25654481 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 320 (L320P)
Ref Sequence ENSEMBL: ENSMUSP00000112340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063344] [ENSMUST00000116641] [ENSMUST00000137201]
Predicted Effect probably damaging
Transcript: ENSMUST00000063344
AA Change: L320P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066682
Gene: ENSMUSG00000002279
AA Change: L320P

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 551 2.3e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116641
AA Change: L320P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112340
Gene: ENSMUSG00000002279
AA Change: L320P

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 553 1.2e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137201
Predicted Effect probably benign
Transcript: ENSMUST00000141606
SMART Domains Protein: ENSMUSP00000129263
Gene: ENSMUSG00000002279

DomainStartEndE-ValueType
Pfam:LMF1 2 90 9.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154842
SMART Domains Protein: ENSMUSP00000119563
Gene: ENSMUSG00000002279

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:LMF1 166 298 2.4e-60 PFAM
Meta Mutation Damage Score 0.6717 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the endoplasmic reticulum, and is involved in the maturation and transport of lipoprotein lipase through the secretory pathway. Mutations in this gene are associated with combined lipase deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in neonatal death following progressive cyanosis, combined lipase deficiency, and hypertriglyceridemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Lmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Lmf1 APN 17 25585650 missense possibly damaging 0.51
R0117:Lmf1 UTSW 17 25655991 unclassified probably benign
R1757:Lmf1 UTSW 17 25655210 missense probably damaging 1.00
R1906:Lmf1 UTSW 17 25612335 missense probably damaging 0.99
R2389:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R2446:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3797:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3798:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3855:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3953:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3955:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3956:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4290:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4291:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4636:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4698:Lmf1 UTSW 17 25579350 missense probably damaging 0.98
R4791:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4792:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4968:Lmf1 UTSW 17 25585618 missense probably damaging 1.00
R4997:Lmf1 UTSW 17 25588676 nonsense probably null
R5047:Lmf1 UTSW 17 25631838 intron probably benign
R5152:Lmf1 UTSW 17 25655519 missense probably damaging 0.99
R5419:Lmf1 UTSW 17 25662636 missense possibly damaging 0.94
R6162:Lmf1 UTSW 17 25612394 missense probably benign 0.00
R6693:Lmf1 UTSW 17 25645278 missense probably benign 0.00
R7583:Lmf1 UTSW 17 25655449 missense
R7642:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R7667:Lmf1 UTSW 17 25654608 critical splice donor site probably null
R7671:Lmf1 UTSW 17 25579349 missense possibly damaging 0.75
R7818:Lmf1 UTSW 17 25662591 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CTTGGGACCAGAACTGAGAG -3'
(R):5'- TTTCATGAGGCTTAGGCAGGAG -3'

Sequencing Primer
(F):5'- CTTGGGACCAGAACTGAGAGAATGG -3'
(R):5'- GCTTAGGCAGGAGGGTCATG -3'
Posted On2015-06-20