Incidental Mutation 'R4293:Atf6b'
ID323190
Institutional Source Beutler Lab
Gene Symbol Atf6b
Ensembl Gene ENSMUSG00000015461
Gene Nameactivating transcription factor 6 beta
SynonymsCreb-rp, ATF6beta, Crebl1
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.674) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34647146-34655074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34652674 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 428 (M428K)
Ref Sequence ENSEMBL: ENSMUSP00000015605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614]
Predicted Effect probably benign
Transcript: ENSMUST00000015605
AA Change: M428K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461
AA Change: M428K

DomainStartEndE-ValueType
low complexity region 86 110 N/A INTRINSIC
internal_repeat_1 113 156 2.55e-13 PROSPERO
low complexity region 162 180 N/A INTRINSIC
internal_repeat_1 186 230 2.55e-13 PROSPERO
low complexity region 238 255 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
BRLZ 320 384 7.08e-15 SMART
low complexity region 415 428 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173984
AA Change: M431K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461
AA Change: M431K

DomainStartEndE-ValueType
low complexity region 89 113 N/A INTRINSIC
internal_repeat_1 116 159 2.54e-13 PROSPERO
low complexity region 165 183 N/A INTRINSIC
internal_repeat_1 189 233 2.54e-13 PROSPERO
low complexity region 241 258 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
BRLZ 323 387 2.9e-17 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
low complexity region 547 560 N/A INTRINSIC
low complexity region 670 696 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174156
Predicted Effect probably benign
Transcript: ENSMUST00000174519
SMART Domains Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174614
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor in the unfolded protein response (UPR) pathway during ER stress. Either as a homodimer or as a heterodimer with ATF6-alpha, the encoded protein binds to the ER stress response element, interacting with nuclear transcription factor Y to activate UPR target genes. The protein is normally found in the membrane of the endoplasmic reticulum; however, under ER stress, the N-terminal cytoplasmic domain is cleaved from the rest of the protein and translocates to the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased cellular sensitivity to thapsigargin and tunicamycin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Atf6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Atf6b APN 17 34649137 missense probably damaging 0.99
IGL02010:Atf6b APN 17 34654652 missense probably benign 0.00
IGL02023:Atf6b APN 17 34651867 missense possibly damaging 0.93
IGL02141:Atf6b APN 17 34653277 missense probably benign 0.01
IGL02511:Atf6b APN 17 34654641 missense probably benign 0.01
IGL03347:Atf6b APN 17 34653240 missense probably damaging 1.00
R0112:Atf6b UTSW 17 34651626 missense probably damaging 0.97
R0285:Atf6b UTSW 17 34650396 unclassified probably benign
R0544:Atf6b UTSW 17 34648299 critical splice donor site probably null
R1618:Atf6b UTSW 17 34647728 nonsense probably null
R1689:Atf6b UTSW 17 34650302 missense probably damaging 0.98
R1823:Atf6b UTSW 17 34648644 missense possibly damaging 0.48
R1996:Atf6b UTSW 17 34652987 critical splice acceptor site probably null
R2057:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R2058:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R2059:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R4290:Atf6b UTSW 17 34652674 missense probably benign 0.00
R4291:Atf6b UTSW 17 34652674 missense probably benign 0.00
R4880:Atf6b UTSW 17 34654555 missense probably damaging 1.00
R4893:Atf6b UTSW 17 34648612 missense probably damaging 1.00
R5406:Atf6b UTSW 17 34653797 nonsense probably null
R5549:Atf6b UTSW 17 34651683 missense probably damaging 1.00
R5702:Atf6b UTSW 17 34651004 missense possibly damaging 0.93
R6386:Atf6b UTSW 17 34651851 missense probably damaging 0.97
R6833:Atf6b UTSW 17 34649157 missense probably damaging 1.00
R6834:Atf6b UTSW 17 34649157 missense probably damaging 1.00
R7094:Atf6b UTSW 17 34653816 critical splice donor site probably null
R7205:Atf6b UTSW 17 34653729 missense probably damaging 1.00
R7261:Atf6b UTSW 17 34650818 missense probably damaging 0.96
R8103:Atf6b UTSW 17 34653975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCTTAGAGTCCTCGTTC -3'
(R):5'- GAGGGGTCTTTCTGCTTCTCAC -3'

Sequencing Primer
(F):5'- ACCTGTGAGATTGGCATCC -3'
(R):5'- TTCTCACCTGAAGCTGGGC -3'
Posted On2015-06-20