Incidental Mutation 'R4293:Cyp2c55'
ID323195
Institutional Source Beutler Lab
Gene Symbol Cyp2c55
Ensembl Gene ENSMUSG00000025002
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms2010318C06Rik
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39007019-39042693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39011791 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 145 (I145F)
Ref Sequence ENSEMBL: ENSMUSP00000025966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025966]
Predicted Effect probably damaging
Transcript: ENSMUST00000025966
AA Change: I145F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025966
Gene: ENSMUSG00000025002
AA Change: I145F

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:p450 30 487 1.1e-154 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175562
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum but its specific substrate has not yet been determined. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. An additional gene, CYP2C17, was once thought to exist; however, CYP2C17 is now considered an artefact based on a chimera of CYP2C18 and CYP2C19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,865,440 E428G probably benign Het
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Cyp2c55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Cyp2c55 APN 19 39011746 missense probably benign 0.41
IGL00537:Cyp2c55 APN 19 39011706 missense possibly damaging 0.93
IGL00959:Cyp2c55 APN 19 39038143 missense probably benign 0.00
IGL01140:Cyp2c55 APN 19 39018649 missense probably benign
IGL01792:Cyp2c55 APN 19 39042187 missense probably benign
PIT4453001:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R0472:Cyp2c55 UTSW 19 39031379 missense probably benign 0.01
R1452:Cyp2c55 UTSW 19 39011090 missense probably damaging 1.00
R1468:Cyp2c55 UTSW 19 39011081 missense probably damaging 0.96
R1468:Cyp2c55 UTSW 19 39011081 missense probably damaging 0.96
R1925:Cyp2c55 UTSW 19 39034377 missense probably benign 0.06
R2154:Cyp2c55 UTSW 19 39034375 missense probably damaging 1.00
R3814:Cyp2c55 UTSW 19 39007065 missense probably damaging 1.00
R4021:Cyp2c55 UTSW 19 39035434 splice site probably null
R4022:Cyp2c55 UTSW 19 39035434 splice site probably null
R4294:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R4604:Cyp2c55 UTSW 19 39031386 missense possibly damaging 0.82
R4740:Cyp2c55 UTSW 19 39018729 missense probably benign
R4756:Cyp2c55 UTSW 19 39031371 missense probably damaging 1.00
R4879:Cyp2c55 UTSW 19 39042078 frame shift probably null
R5039:Cyp2c55 UTSW 19 39038143 missense probably benign 0.00
R5672:Cyp2c55 UTSW 19 39035546 missense probably benign 0.02
R5834:Cyp2c55 UTSW 19 39042067 missense probably benign 0.00
R6198:Cyp2c55 UTSW 19 39007121 nonsense probably null
R6255:Cyp2c55 UTSW 19 39018667 missense probably benign 0.25
R6431:Cyp2c55 UTSW 19 39031409 missense probably damaging 0.99
R6565:Cyp2c55 UTSW 19 39042122 missense probably benign 0.09
X0062:Cyp2c55 UTSW 19 39018689 missense probably damaging 0.98
Z1176:Cyp2c55 UTSW 19 39035513 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAGGGACTAGACAGGAAAATCTCC -3'
(R):5'- AGCAAAGCTCTGTCCTTGG -3'

Sequencing Primer
(F):5'- ACAGGTTCAGAGGTTCAGTCC -3'
(R):5'- AAAGCTCTGTCCTTGGGCACTAG -3'
Posted On2015-06-20