Incidental Mutation 'R4294:Fhdc1'
ID323205
Institutional Source Beutler Lab
Gene Symbol Fhdc1
Ensembl Gene ENSMUSG00000041842
Gene NameFH2 domain containing 1
Synonyms6330505N24Rik
MMRRC Submission 041083-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4294 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location84442198-84480429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84444826 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1031 (V1031F)
Ref Sequence ENSEMBL: ENSMUSP00000103317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091002] [ENSMUST00000107689] [ENSMUST00000194027]
Predicted Effect probably benign
Transcript: ENSMUST00000091002
AA Change: V1031F

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088525
Gene: ENSMUSG00000041842
AA Change: V1031F

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107689
AA Change: V1031F

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103317
Gene: ENSMUSG00000041842
AA Change: V1031F

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125643
Predicted Effect probably benign
Transcript: ENSMUST00000194027
SMART Domains Protein: ENSMUSP00000142030
Gene: ENSMUSG00000041842

DomainStartEndE-ValueType
Pfam:FH2 1 145 3.8e-22 PFAM
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A T 19: 21,598,749 probably null Het
Abca3 A G 17: 24,400,569 I960M possibly damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bsnd C T 4: 106,485,158 R271H probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Clip2 A C 5: 134,492,313 V957G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dlc1 A G 8: 36,584,753 V608A possibly damaging Het
Dlg3 A T X: 100,796,682 probably benign Het
Dock3 T A 9: 106,930,043 R1362W probably damaging Het
Gimap8 A T 6: 48,658,957 H552L probably benign Het
Gpr151 T C 18: 42,578,537 T359A probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Magel2 T G 7: 62,378,767 V473G possibly damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Nat8f1 T C 6: 85,910,655 T108A probably benign Het
Nphp3 T A 9: 104,022,717 L502Q probably damaging Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Otud7a A G 7: 63,697,191 D171G probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Rpl27-ps3 T A 18: 6,332,607 probably null Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgsm1 A G 5: 113,285,404 Y182H probably damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Thrb C T 14: 18,011,145 Q174* probably null Het
Ticam1 A G 17: 56,271,339 I252T probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Trpv1 C T 11: 73,240,464 A276V probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r74 T A 7: 85,957,416 I241F probably benign Het
Other mutations in Fhdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Fhdc1 APN 3 84448800 missense probably damaging 1.00
IGL00556:Fhdc1 APN 3 84457242 missense possibly damaging 0.81
IGL00951:Fhdc1 APN 3 84464313 missense possibly damaging 0.90
IGL01744:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01754:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01762:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01764:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01769:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01778:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01779:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01781:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02243:Fhdc1 APN 3 84474640 start codon destroyed possibly damaging 0.89
IGL02260:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02261:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02266:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02271:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02284:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02292:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02296:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02301:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02347:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02416:Fhdc1 APN 3 84445228 missense probably benign 0.03
IGL03189:Fhdc1 APN 3 84455061 intron probably benign
IGL03392:Fhdc1 APN 3 84444519 missense possibly damaging 0.55
R0125:Fhdc1 UTSW 3 84445545 missense probably benign
R0135:Fhdc1 UTSW 3 84445618 missense probably damaging 0.97
R0255:Fhdc1 UTSW 3 84453510 intron probably benign
R0401:Fhdc1 UTSW 3 84444624 missense probably benign 0.02
R1371:Fhdc1 UTSW 3 84445003 missense probably damaging 1.00
R1727:Fhdc1 UTSW 3 84446176 missense possibly damaging 0.50
R1769:Fhdc1 UTSW 3 84448778 missense probably damaging 1.00
R1781:Fhdc1 UTSW 3 84448804 missense probably damaging 0.99
R1840:Fhdc1 UTSW 3 84445821 missense possibly damaging 0.46
R1970:Fhdc1 UTSW 3 84454851 missense probably damaging 1.00
R2038:Fhdc1 UTSW 3 84444561 missense probably benign 0.22
R2088:Fhdc1 UTSW 3 84474726 start gained probably benign
R2256:Fhdc1 UTSW 3 84446046 missense probably benign
R2939:Fhdc1 UTSW 3 84457270 missense possibly damaging 0.47
R3813:Fhdc1 UTSW 3 84464270 critical splice donor site probably null
R4022:Fhdc1 UTSW 3 84445102 missense probably benign 0.01
R4175:Fhdc1 UTSW 3 84456987 intron probably benign
R4243:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4245:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4290:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4291:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4292:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4293:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4295:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4334:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4335:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4342:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4344:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4354:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4550:Fhdc1 UTSW 3 84445176 missense probably benign 0.16
R4626:Fhdc1 UTSW 3 84474250 missense probably damaging 1.00
R4925:Fhdc1 UTSW 3 84453533 missense probably damaging 1.00
R5155:Fhdc1 UTSW 3 84446150 missense probably benign 0.00
R5588:Fhdc1 UTSW 3 84465476 missense possibly damaging 0.91
R6043:Fhdc1 UTSW 3 84448886 missense probably damaging 0.96
R6063:Fhdc1 UTSW 3 84446029 missense probably benign 0.00
R6652:Fhdc1 UTSW 3 84464324 missense probably damaging 1.00
R6706:Fhdc1 UTSW 3 84446422 missense probably damaging 1.00
R6783:Fhdc1 UTSW 3 84445527 missense probably benign 0.00
R6984:Fhdc1 UTSW 3 84444516 missense possibly damaging 0.93
R7182:Fhdc1 UTSW 3 84448850 missense probably damaging 0.98
R7299:Fhdc1 UTSW 3 84444540 missense probably damaging 1.00
R7574:Fhdc1 UTSW 3 84446131 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGTCCTTGGAGGCAGAATC -3'
(R):5'- AGGAACTTCGGACACTTCGC -3'

Sequencing Primer
(F):5'- AGAATCCTCGGAGCCACCTTTG -3'
(R):5'- TCGAGTGGCAGCATCAGTG -3'
Posted On2015-06-20