Incidental Mutation 'R4294:Bsnd'
ID323207
Institutional Source Beutler Lab
Gene Symbol Bsnd
Ensembl Gene ENSMUSG00000025418
Gene Namebarttin CLCNK type accessory beta subunit
Synonyms
MMRRC Submission 041083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4294 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location106483456-106492283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106485158 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 271 (R271H)
Ref Sequence ENSEMBL: ENSMUSP00000049563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054472]
Predicted Effect probably benign
Transcript: ENSMUST00000054472
AA Change: R271H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000049563
Gene: ENSMUSG00000025418
AA Change: R271H

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Barttin 27 241 5.2e-110 PFAM
low complexity region 273 280 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential beta subunit for CLC chloride channels. These heteromeric channels localize to basolateral membranes of renal tubules and of potassium-secreting epithelia of the inner ear. Mutations in this gene have been associated with Bartter syndrome with sensorineural deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe dehydration and postnatal lethality. Mice homozygous for a cre-activated conditional allele exhibit hearing loss with outer hair cell and stria vascularis degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A T 19: 21,598,749 probably null Het
Abca3 A G 17: 24,400,569 I960M possibly damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Clip2 A C 5: 134,492,313 V957G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dlc1 A G 8: 36,584,753 V608A possibly damaging Het
Dlg3 A T X: 100,796,682 probably benign Het
Dock3 T A 9: 106,930,043 R1362W probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gimap8 A T 6: 48,658,957 H552L probably benign Het
Gpr151 T C 18: 42,578,537 T359A probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Magel2 T G 7: 62,378,767 V473G possibly damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Nat8f1 T C 6: 85,910,655 T108A probably benign Het
Nphp3 T A 9: 104,022,717 L502Q probably damaging Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Otud7a A G 7: 63,697,191 D171G probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Rpl27-ps3 T A 18: 6,332,607 probably null Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgsm1 A G 5: 113,285,404 Y182H probably damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Thrb C T 14: 18,011,145 Q174* probably null Het
Ticam1 A G 17: 56,271,339 I252T probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Trpv1 C T 11: 73,240,464 A276V probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r74 T A 7: 85,957,416 I241F probably benign Het
Other mutations in Bsnd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03220:Bsnd APN 4 106486765 missense possibly damaging 0.58
IGL02802:Bsnd UTSW 4 106492034 missense probably damaging 1.00
R1327:Bsnd UTSW 4 106486612 missense probably benign 0.08
R1869:Bsnd UTSW 4 106486636 missense probably benign 0.03
R1912:Bsnd UTSW 4 106488030 nonsense probably null
R4411:Bsnd UTSW 4 106486671 missense probably benign
R5241:Bsnd UTSW 4 106487985 missense probably benign 0.21
R5733:Bsnd UTSW 4 106488001 missense probably benign 0.08
R6274:Bsnd UTSW 4 106486635 missense probably damaging 0.96
R6483:Bsnd UTSW 4 106488015 missense probably damaging 0.99
R7153:Bsnd UTSW 4 106492033 missense probably benign 0.09
R7184:Bsnd UTSW 4 106491912 missense probably damaging 1.00
X0023:Bsnd UTSW 4 106485417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGGGGTCACATGAAGAC -3'
(R):5'- CTCATTCCATGACGACCTGGAC -3'

Sequencing Primer
(F):5'- TCACATGAAGACAGCAGTGC -3'
(R):5'- ATGACGACCTGGACGTGGG -3'
Posted On2015-06-20