Incidental Mutation 'R4294:Sgsm1'
ID 323209
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
MMRRC Submission 041083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4294 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113285404 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 182 (Y182H)
Ref Sequence ENSEMBL: ENSMUSP00000114932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112324] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048112
AA Change: Y182H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: Y182H

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057209
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112324
SMART Domains Protein: ENSMUSP00000107943
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112325
AA Change: Y182H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: Y182H

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147856
Predicted Effect probably damaging
Transcript: ENSMUST00000154248
AA Change: Y182H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: Y182H

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Meta Mutation Damage Score 0.7359 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A T 19: 21,598,749 probably null Het
Abca3 A G 17: 24,400,569 I960M possibly damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bsnd C T 4: 106,485,158 R271H probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Clip2 A C 5: 134,492,313 V957G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dlc1 A G 8: 36,584,753 V608A possibly damaging Het
Dlg3 A T X: 100,796,682 probably benign Het
Dock3 T A 9: 106,930,043 R1362W probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gimap8 A T 6: 48,658,957 H552L probably benign Het
Gpr151 T C 18: 42,578,537 T359A probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Magel2 T G 7: 62,378,767 V473G possibly damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Nat8f1 T C 6: 85,910,655 T108A probably benign Het
Nphp3 T A 9: 104,022,717 L502Q probably damaging Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Otud7a A G 7: 63,697,191 D171G probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Rpl27-ps3 T A 18: 6,332,607 probably null Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Thrb C T 14: 18,011,145 Q174* probably null Het
Ticam1 A G 17: 56,271,339 I252T probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Trpv1 C T 11: 73,240,464 A276V probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r74 T A 7: 85,957,416 I241F probably benign Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113279231 missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113280341 missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATGAGGCAGTGACCACAGTC -3'
(R):5'- GACCTGTCTCTTCTGAAGTGTC -3'

Sequencing Primer
(F):5'- TGCCCCGAAGCCAAGTC -3'
(R):5'- AAGTGTCTTCTTGCTGGACTC -3'
Posted On 2015-06-20