Mutagenetix > Incidental Mutation

Incidental Mutation 'R4294:Nphp3'

323221

Institutional Source

Beutler Lab

Gene Symbol

Nphp3

Ensembl Gene

ENSMUSG00000032558

Gene Name

nephronophthisis 3 (adolescent)

Synonyms

3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3

MMRRC Submission

041083-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4294 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104002544-104043818 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 104022717 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 502 (L502Q)

Ref Sequence

ENSEMBL: ENSMUSP00000141540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]

AlphaFold

Q7TNH6

Predicted Effect

probably damaging
Transcript: ENSMUST00000035167
AA Change: L596Q

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: L596Q

Domain	Start	End	E-Value	Type
low complexity region	46	69	N/A	INTRINSIC
coiled coil region	107	203	N/A	INTRINSIC
low complexity region	512	537	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC
low complexity region	640	650	N/A	INTRINSIC
TPR	938	971	3.16e1	SMART
TPR	980	1013	7.74e-2	SMART
TPR	1022	1055	3.24e1	SMART
low complexity region	1066	1080	N/A	INTRINSIC
TPR	1088	1121	3.67e-3	SMART
TPR	1130	1163	1.3e-3	SMART
TPR	1172	1205	4.38e-1	SMART
TPR	1214	1247	8.69e-5	SMART
TPR	1256	1289	9.03e-3	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558
AA Change: L476Q

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000193439
AA Change: L502Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558
AA Change: L502Q

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193642

Predicted Effect

probably damaging
Transcript: ENSMUST00000194774
AA Change: L476Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: L476Q

Domain	Start	End	E-Value	Type
coiled coil region	49	83	N/A	INTRINSIC
Pfam:NACHT	400	559	2e-6	PFAM
TPR	818	851	3.16e1	SMART
TPR	860	893	7.74e-2	SMART
TPR	902	935	3.24e1	SMART
low complexity region	946	960	N/A	INTRINSIC
TPR	968	1001	3.67e-3	SMART
TPR	1010	1043	1.3e-3	SMART
TPR	1052	1085	4.38e-1	SMART
TPR	1094	1127	8.69e-5	SMART
TPR	1136	1169	9.03e-3	SMART

Meta Mutation Damage Score

0.0889

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059E24Rik	A	T	19: 21,598,749		probably null	Het
Abca3	A	G	17: 24,400,569	I960M	possibly damaging	Het
Bivm	A	T	1: 44,138,633	R364S	probably damaging	Het
Bsnd	C	T	4: 106,485,158	R271H	probably benign	Het
Cckar	A	G	5: 53,706,497	S41P	probably benign	Het
Clip2	A	C	5: 134,492,313	V957G	probably benign	Het
Cyp2c55	A	T	19: 39,011,791	I145F	probably damaging	Het
Cyp3a11	A	T	5: 145,869,195	S121T	probably benign	Het
Dlc1	A	G	8: 36,584,753	V608A	possibly damaging	Het
Dlg3	A	T	X: 100,796,682		probably benign	Het
Dock3	T	A	9: 106,930,043	R1362W	probably damaging	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Gimap8	A	T	6: 48,658,957	H552L	probably benign	Het
Gpr151	T	C	18: 42,578,537	T359A	probably benign	Het
Gucy1a1	A	T	3: 82,094,759	F671Y	possibly damaging	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Kif18a	T	C	2: 109,293,053	V224A	probably benign	Het
Lbr	C	T	1: 181,820,702	C398Y	probably damaging	Het
Magel2	T	G	7: 62,378,767	V473G	possibly damaging	Het
Mapkapk3	T	C	9: 107,258,932		probably benign	Het
Nat8f1	T	C	6: 85,910,655	T108A	probably benign	Het
Olfr1396	T	A	11: 49,113,427	I100L	probably benign	Het
Otud7a	A	G	7: 63,697,191	D171G	probably damaging	Het
Pcdhb5	T	A	18: 37,322,681	S705T	possibly damaging	Het
Phf14	C	T	6: 11,987,097	P559S	probably damaging	Het
Rpl27-ps3	T	A	18: 6,332,607		probably null	Het
Sec16a	A	G	2: 26,422,155	Y1998H	probably benign	Het
Setd5	AT	ATT	6: 113,111,320		probably benign	Het
Sgsm1	A	G	5: 113,285,404	Y182H	probably damaging	Het
Slc22a21	T	C	11: 53,969,503	D34G	probably damaging	Het
Spata13	T	A	14: 60,709,555	M684K	probably damaging	Het
Srsf6	T	C	2: 162,934,716		probably benign	Het
Thrb	C	T	14: 18,011,145	Q174*	probably null	Het
Ticam1	A	G	17: 56,271,339	I252T	probably benign	Het
Tmem237	A	G	1: 59,119,836		probably benign	Het
Trpv1	C	T	11: 73,240,464	A276V	probably damaging	Het
Vmn1r192	T	A	13: 22,187,295	I252F	probably damaging	Het
Vmn2r74	T	A	7: 85,957,416	I241F	probably benign	Het

Other mutations in Nphp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01707:Nphp3	APN	9	104018158	missense	possibly damaging	0.75
IGL02329:Nphp3	APN	9	104025968	missense	probably benign	0.19
lithograph	UTSW	9	104041990	missense	probably damaging	1.00
quartzite	UTSW	9	104036177	missense	probably damaging	1.00
F5770:Nphp3	UTSW	9	104035894	critical splice donor site	probably null
FR4548:Nphp3	UTSW	9	104025939	small deletion	probably benign
FR4589:Nphp3	UTSW	9	104025939	small deletion	probably benign
R0112:Nphp3	UTSW	9	104037348	missense	possibly damaging	0.80
R0555:Nphp3	UTSW	9	104023434	missense	probably damaging	1.00
R0632:Nphp3	UTSW	9	104018274	missense	probably damaging	1.00
R0674:Nphp3	UTSW	9	104036282	critical splice donor site	probably null
R0743:Nphp3	UTSW	9	104022768	small deletion	probably benign
R0853:Nphp3	UTSW	9	104031933	missense	probably benign	0.03
R0920:Nphp3	UTSW	9	104031907	missense	probably benign	0.00
R1420:Nphp3	UTSW	9	104035893	critical splice donor site	probably null
R1464:Nphp3	UTSW	9	104031879	splice site	probably benign
R1476:Nphp3	UTSW	9	104025927	missense	possibly damaging	0.81
R1585:Nphp3	UTSW	9	104009214	missense	probably damaging	1.00
R1608:Nphp3	UTSW	9	104035840	missense	probably benign	0.30
R1688:Nphp3	UTSW	9	104003124	missense	probably damaging	1.00
R1691:Nphp3	UTSW	9	104002811	missense	probably benign
R1807:Nphp3	UTSW	9	104020741	missense	probably benign	0.01
R1857:Nphp3	UTSW	9	104021294	missense	possibly damaging	0.87
R1962:Nphp3	UTSW	9	104021338	missense	probably benign	0.00
R2127:Nphp3	UTSW	9	104008243	missense	probably damaging	0.98
R2138:Nphp3	UTSW	9	104025903	missense	possibly damaging	0.89
R2233:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R2234:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R3861:Nphp3	UTSW	9	104039326	unclassified	probably benign
R3928:Nphp3	UTSW	9	104011730	missense	probably damaging	0.99
R3961:Nphp3	UTSW	9	104003042	nonsense	probably null
R4182:Nphp3	UTSW	9	104038464	missense	probably benign	0.06
R4387:Nphp3	UTSW	9	104030020	missense	possibly damaging	0.94
R4625:Nphp3	UTSW	9	104036159	missense	possibly damaging	0.66
R4628:Nphp3	UTSW	9	104003058	missense	probably damaging	0.99
R4696:Nphp3	UTSW	9	104022732	missense	probably benign	0.01
R4865:Nphp3	UTSW	9	104031970	missense	probably benign
R4886:Nphp3	UTSW	9	104002994	missense	probably damaging	1.00
R4973:Nphp3	UTSW	9	104031999	missense	probably benign
R5445:Nphp3	UTSW	9	104004723	missense	probably damaging	1.00
R5451:Nphp3	UTSW	9	104042022	missense	probably benign
R5520:Nphp3	UTSW	9	104024673	missense	probably benign	0.30
R5641:Nphp3	UTSW	9	104036153	missense	probably damaging	1.00
R5847:Nphp3	UTSW	9	104003037	missense	probably damaging	1.00
R5928:Nphp3	UTSW	9	104035797	missense	probably benign	0.01
R5931:Nphp3	UTSW	9	104020746	missense	probably damaging	1.00
R6161:Nphp3	UTSW	9	104031906	missense	probably benign	0.11
R6298:Nphp3	UTSW	9	104015441	missense	probably damaging	1.00
R6890:Nphp3	UTSW	9	104041954	missense	probably damaging	0.96
R7009:Nphp3	UTSW	9	104016116	missense	probably null	0.00
R7065:Nphp3	UTSW	9	104041990	missense	probably damaging	1.00
R7146:Nphp3	UTSW	9	104004837	nonsense	probably null
R7198:Nphp3	UTSW	9	104004775	missense	probably damaging	1.00
R7360:Nphp3	UTSW	9	104016078	critical splice acceptor site	probably null
R7369:Nphp3	UTSW	9	104018250	missense	probably damaging	0.99
R7554:Nphp3	UTSW	9	104042071	missense	probably damaging	0.98
R7591:Nphp3	UTSW	9	104018278	critical splice donor site	probably null
R7665:Nphp3	UTSW	9	104005393	splice site	probably null
R7672:Nphp3	UTSW	9	104031960	missense	probably benign
R7675:Nphp3	UTSW	9	104016088	missense	probably benign
R8039:Nphp3	UTSW	9	104031963	missense	probably benign
R8145:Nphp3	UTSW	9	104035851	missense	probably benign	0.16
R8211:Nphp3	UTSW	9	104031897	missense	possibly damaging	0.80
R8882:Nphp3	UTSW	9	104005594	missense	possibly damaging	0.77
R9020:Nphp3	UTSW	9	104031951	missense	probably benign	0.00
R9132:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9135:Nphp3	UTSW	9	104032015	missense	probably damaging	0.99
R9159:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9204:Nphp3	UTSW	9	104042106	missense	probably benign
R9226:Nphp3	UTSW	9	104008129	missense	probably benign	0.00
R9229:Nphp3	UTSW	9	104036177	missense	probably damaging	1.00
R9526:Nphp3	UTSW	9	104036138	missense	probably damaging	1.00
R9678:Nphp3	UTSW	9	104023487	missense	possibly damaging	0.90
R9731:Nphp3	UTSW	9	104009170	missense	probably damaging	1.00
V7583:Nphp3	UTSW	9	104035894	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CATACATGTCTGTGTGCACATGC -3'
(R):5'- AGAACTGAGATGGCACTGC -3'

Sequencing Primer
(F):5'- ACACACCGGTACTTCACTGTGG -3'
(R):5'- GCACTGCCACCATTGCG -3'

Posted On

2015-06-20