Incidental Mutation 'R4294:Gpr151'
ID323236
Institutional Source Beutler Lab
Gene Symbol Gpr151
Ensembl Gene ENSMUSG00000042816
Gene NameG protein-coupled receptor 151
SynonymsPGR7, C130082O03Rik, GalRL
MMRRC Submission 041083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4294 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42578020-42579652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42578537 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 359 (T359A)
Ref Sequence ENSEMBL: ENSMUSP00000058887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000054738] [ENSMUST00000173642]
Predicted Effect probably benign
Transcript: ENSMUST00000025375
SMART Domains Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
FF 1014 1079 1.3e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054738
AA Change: T359A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058887
Gene: ENSMUSG00000042816
AA Change: T359A

DomainStartEndE-ValueType
Pfam:7tm_1 57 310 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173642
SMART Domains Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184771
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the galanin receptor subfamily of G protein-coupled receptors. The encoded protein is found predominantly in the central nervous system. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A T 19: 21,598,749 probably null Het
Abca3 A G 17: 24,400,569 I960M possibly damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bsnd C T 4: 106,485,158 R271H probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Clip2 A C 5: 134,492,313 V957G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dlc1 A G 8: 36,584,753 V608A possibly damaging Het
Dlg3 A T X: 100,796,682 probably benign Het
Dock3 T A 9: 106,930,043 R1362W probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gimap8 A T 6: 48,658,957 H552L probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Magel2 T G 7: 62,378,767 V473G possibly damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Nat8f1 T C 6: 85,910,655 T108A probably benign Het
Nphp3 T A 9: 104,022,717 L502Q probably damaging Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Otud7a A G 7: 63,697,191 D171G probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Rpl27-ps3 T A 18: 6,332,607 probably null Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgsm1 A G 5: 113,285,404 Y182H probably damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Thrb C T 14: 18,011,145 Q174* probably null Het
Ticam1 A G 17: 56,271,339 I252T probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Trpv1 C T 11: 73,240,464 A276V probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r74 T A 7: 85,957,416 I241F probably benign Het
Other mutations in Gpr151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Gpr151 APN 18 42578770 missense probably benign 0.03
IGL03167:Gpr151 APN 18 42578374 missense probably benign 0.06
R1561:Gpr151 UTSW 18 42579156 missense probably benign 0.42
R3875:Gpr151 UTSW 18 42578596 missense probably benign 0.02
R5188:Gpr151 UTSW 18 42578755 missense probably benign
R5431:Gpr151 UTSW 18 42578867 missense probably damaging 1.00
R5815:Gpr151 UTSW 18 42579385 missense probably benign 0.00
R6199:Gpr151 UTSW 18 42578554 missense probably benign 0.31
R6302:Gpr151 UTSW 18 42579394 missense probably damaging 1.00
R6891:Gpr151 UTSW 18 42578920 missense probably benign 0.15
R7180:Gpr151 UTSW 18 42578956 nonsense probably null
R8262:Gpr151 UTSW 18 42578372 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAAGTCTGTTAATTGCAGCCC -3'
(R):5'- AGCCCTGTCTCAAGTTCTCATG -3'

Sequencing Primer
(F):5'- TGTTAATTGCAGCCCTCTGTC -3'
(R):5'- ATGTTTTTCACCTCCACAGCAAAC -3'
Posted On2015-06-20