Incidental Mutation 'R4294:Dlg3'
ID323238
Institutional Source Beutler Lab
Gene Symbol Dlg3
Ensembl Gene ENSMUSG00000000881
Gene Namediscs large MAGUK scaffold protein 3
SynonymsDlgh3, DLG3, SAP102
MMRRC Submission 041083-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R4294 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location100767722-100818410 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 100796682 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000901] [ENSMUST00000087984] [ENSMUST00000113735] [ENSMUST00000113736]
Predicted Effect probably benign
Transcript: ENSMUST00000000901
SMART Domains Protein: ENSMUSP00000000901
Gene: ENSMUSG00000000881

DomainStartEndE-ValueType
MAGUK_N_PEST 49 130 5.38e-8 SMART
PDZ 139 218 3.88e-21 SMART
PDZ 234 313 1.15e-23 SMART
PDZ 394 467 3.59e-25 SMART
low complexity region 484 495 N/A INTRINSIC
SH3 504 570 2.28e-11 SMART
GuKc 626 805 7.7e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087984
SMART Domains Protein: ENSMUSP00000085299
Gene: ENSMUSG00000000881

DomainStartEndE-ValueType
MAGUK_N_PEST 49 148 5.74e-26 SMART
PDZ 157 236 3.88e-21 SMART
PDZ 252 331 1.15e-23 SMART
PDZ 412 485 3.59e-25 SMART
low complexity region 502 513 N/A INTRINSIC
SH3 522 588 2.28e-11 SMART
low complexity region 629 638 N/A INTRINSIC
GuKc 658 837 7.7e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113735
SMART Domains Protein: ENSMUSP00000109364
Gene: ENSMUSG00000000881

DomainStartEndE-ValueType
low complexity region 8 33 N/A INTRINSIC
PDZ 57 130 3.59e-25 SMART
low complexity region 147 158 N/A INTRINSIC
SH3 167 233 2.28e-11 SMART
low complexity region 257 272 N/A INTRINSIC
low complexity region 292 301 N/A INTRINSIC
GuKc 321 500 7.7e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113736
SMART Domains Protein: ENSMUSP00000109365
Gene: ENSMUSG00000000881

DomainStartEndE-ValueType
MAGUK_N_PEST 49 148 5.74e-26 SMART
PDZ 157 236 3.88e-21 SMART
PDZ 252 331 1.15e-23 SMART
PDZ 412 485 3.59e-25 SMART
low complexity region 502 513 N/A INTRINSIC
SH3 522 588 2.28e-11 SMART
GuKc 644 823 7.7e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151020
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase protein family. The encoded protein may play a role in clustering of NMDA receptors at excitatory synapses. It may also negatively regulate cell proliferation through interaction with the C-terminal region of the adenomatosis polyposis coli tumor suppressor protein. Mutations in this gene have been associated with X-linked mental retardation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009]
PHENOTYPE: Male mice hemizygous for a knock-out allele show alterations in spatial learning, locomotor activation, LTP, and spike-timing-dependent plasticity. A portion of chimeras hemizygous for a gene trapped allele display forebrain deletion, posterior truncation, and failure to initiate embryo turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A T 19: 21,598,749 probably null Het
Abca3 A G 17: 24,400,569 I960M possibly damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bsnd C T 4: 106,485,158 R271H probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Clip2 A C 5: 134,492,313 V957G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dlc1 A G 8: 36,584,753 V608A possibly damaging Het
Dock3 T A 9: 106,930,043 R1362W probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gimap8 A T 6: 48,658,957 H552L probably benign Het
Gpr151 T C 18: 42,578,537 T359A probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Magel2 T G 7: 62,378,767 V473G possibly damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Nat8f1 T C 6: 85,910,655 T108A probably benign Het
Nphp3 T A 9: 104,022,717 L502Q probably damaging Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Otud7a A G 7: 63,697,191 D171G probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Rpl27-ps3 T A 18: 6,332,607 probably null Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgsm1 A G 5: 113,285,404 Y182H probably damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Thrb C T 14: 18,011,145 Q174* probably null Het
Ticam1 A G 17: 56,271,339 I252T probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Trpv1 C T 11: 73,240,464 A276V probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r74 T A 7: 85,957,416 I241F probably benign Het
Other mutations in Dlg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Dlg3 APN X 100806593 missense probably damaging 0.99
IGL01287:Dlg3 APN X 100807242 missense possibly damaging 0.51
IGL02225:Dlg3 APN X 100807188 missense probably benign 0.01
IGL02377:Dlg3 APN X 100773401 missense possibly damaging 0.92
IGL03268:Dlg3 APN X 100809887 missense probably damaging 0.98
R2192:Dlg3 UTSW X 100774221 missense probably damaging 0.98
R4290:Dlg3 UTSW X 100796682 splice site probably benign
R4293:Dlg3 UTSW X 100796682 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TTTGCCATGCCCAAATGCAAC -3'
(R):5'- CCTACCAGTTAGCCAAGAGC -3'

Sequencing Primer
(F):5'- CCCTTCTTGGTGGGGAGG -3'
(R):5'- CAAGAGCAGCTAGGCCG -3'
Posted On2015-06-20