Incidental Mutation 'R0003:Igf1r'
ID32324
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Nameinsulin-like growth factor I receptor
Synonymsline 186, A330103N21Rik, CD221, hyft, IGF-1R
MMRRC Submission 038299-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0003 (G1)
Quality Score193
Status Validated
Chromosome7
Chromosomal Location67952827-68233668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68165242 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 297 (V297A)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
Predicted Effect probably damaging
Transcript: ENSMUST00000005671
AA Change: V297A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: V297A

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207621
Meta Mutation Damage Score 0.4113 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,578 V1903E possibly damaging Het
Adam19 T A 11: 46,128,789 C439S probably damaging Het
Adnp2 T C 18: 80,130,990 Y68C probably damaging Het
Ahctf1 A T 1: 179,763,473 D1247E probably benign Het
Alms1 T A 6: 85,629,210 M2614K possibly damaging Het
Alx3 A G 3: 107,604,976 H310R probably damaging Het
Ambra1 C T 2: 91,911,428 T1016M probably damaging Het
Ankrd35 A G 3: 96,684,015 E539G probably damaging Het
Aptx A G 4: 40,695,145 probably benign Het
Arsi C T 18: 60,916,986 R314C probably benign Het
Atp1a3 T C 7: 24,989,564 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
BC067074 T A 13: 113,368,776 S2146R probably benign Het
Bicra G T 7: 15,971,887 T1543K probably benign Het
Bzw2 A C 12: 36,130,015 I71S probably damaging Het
Camk2a C T 18: 60,960,007 A302V probably damaging Het
Ccdc12 A G 9: 110,656,597 E12G possibly damaging Het
Cd300lb A T 11: 114,928,338 F19Y probably benign Het
Clcn3 A T 8: 60,927,296 C535* probably null Het
Cntnap5c A G 17: 58,199,017 T679A probably benign Het
Cpsf7 G A 19: 10,539,629 S365N possibly damaging Het
Cyp20a1 T C 1: 60,387,126 probably benign Het
Decr2 A T 17: 26,083,053 N234K probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dnah12 T C 14: 26,772,644 F1300L probably damaging Het
Dock1 T C 7: 134,730,064 probably benign Het
Dpy19l4 A T 4: 11,267,619 N440K probably damaging Het
Eprs T C 1: 185,414,391 V1206A probably damaging Het
Exoc6b A G 6: 84,854,699 probably null Het
Fam184b A G 5: 45,555,194 probably benign Het
Fcho1 A T 8: 71,708,953 S858T probably damaging Het
Fgfr1 A G 8: 25,568,198 D430G possibly damaging Het
Fmnl3 T C 15: 99,321,132 T807A probably damaging Het
Gabra5 T C 7: 57,413,728 Y316C probably damaging Het
Gh A G 11: 106,301,520 L16P probably damaging Het
Glipr2 A T 4: 43,970,532 I87F probably damaging Het
Glrb T A 3: 80,855,914 I259F probably damaging Het
Gpr63 T C 4: 25,007,651 L125P probably damaging Het
Grb2 A G 11: 115,655,425 Y37H probably damaging Het
Haus2 G A 2: 120,618,968 probably benign Het
Hmgcr T C 13: 96,652,145 N749S probably damaging Het
Il12rb2 G T 6: 67,316,286 P69H probably damaging Het
Ints3 C A 3: 90,408,511 M315I probably benign Het
Izumo2 C T 7: 44,715,409 T116I probably benign Het
Kctd19 A C 8: 105,395,361 Y185D probably damaging Het
Lama4 A G 10: 39,060,222 N631S possibly damaging Het
Lama5 T G 2: 180,178,079 probably null Het
Lamc1 A C 1: 153,262,439 L223R probably damaging Het
Lgr4 G A 2: 109,997,665 probably null Het
Loxhd1 T C 18: 77,339,500 L398P probably damaging Het
Mapk9 T A 11: 49,867,039 D103E possibly damaging Het
March6 T C 15: 31,469,532 probably benign Het
Mlxipl G A 5: 135,133,189 probably benign Het
Mrgbp C A 2: 180,583,438 D62E probably benign Het
Mtap A T 4: 89,151,998 probably benign Het
Myt1 G A 2: 181,801,871 G497S probably damaging Het
Naa25 T G 5: 121,407,184 probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkpd1 T C 7: 19,519,927 C73R probably benign Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Nvl C A 1: 181,114,133 D581Y probably damaging Het
Olfr1102 T A 2: 87,002,366 Y132* probably null Het
Olfr1500 T C 19: 13,827,686 T237A probably damaging Het
Olfr568 T C 7: 102,877,861 V247A probably benign Het
Olfr575 T C 7: 102,954,978 M208V probably benign Het
Olfr905 A G 9: 38,473,316 T190A probably benign Het
Pcdh7 G T 5: 57,913,248 E1089D probably benign Het
Pik3cd A G 4: 149,656,379 probably null Het
Plekhh2 A T 17: 84,557,392 K69N probably damaging Het
Ptgdr2 G A 19: 10,940,428 C103Y probably damaging Het
Rrad A C 8: 104,628,667 H236Q probably benign Het
Rslcan18 C T 13: 67,098,469 A236T probably benign Het
Ryr2 C A 13: 11,824,379 D503Y probably damaging Het
Siglec1 T C 2: 131,075,060 T1092A probably benign Het
Siglecf A G 7: 43,355,926 T437A probably benign Het
Spta1 A T 1: 174,205,273 Q965H probably damaging Het
Stk10 A T 11: 32,589,460 E280V probably benign Het
Tfg T C 16: 56,690,988 Y326C possibly damaging Het
Tpp2 T A 1: 43,960,139 S358T possibly damaging Het
Trim25 G T 11: 89,015,772 V437L probably benign Het
Ttn T C 2: 76,743,683 D25622G probably damaging Het
Ube3b T A 5: 114,398,851 S303R probably benign Het
Ush2a T A 1: 188,578,491 V2088D probably damaging Het
Vmn2r103 A G 17: 19,811,979 T672A probably damaging Het
Wdr11 G T 7: 129,599,061 G79C probably damaging Het
Wdr89 T A 12: 75,632,593 T296S probably benign Het
Zdhhc24 T A 19: 4,880,374 L179M possibly damaging Het
Zfp981 T C 4: 146,537,760 C381R probably damaging Het
Zim1 A G 7: 6,676,948 I572T probably benign Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7923:Igf1r UTSW 7 68190101 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
R8368:Igf1r UTSW 7 68187048 missense probably benign 0.03
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTCATCCCATAGCAAACCAGG -3'
(R):5'- GGCCAGCAAGCTAATTCTTACGCTC -3'

Sequencing Primer
(F):5'- GACGGTAAGATCTACGCAGATTTC -3'
(R):5'- AAGCTAATTCTTACGCTCTAGTGC -3'
Posted On2013-05-09