Mutagenetix > Incidental Mutations

Incidental Mutation 'R4295:Olfr1032'

323245

Institutional Source

Beutler Lab

Gene Symbol

Olfr1032

Ensembl Gene

ENSMUSG00000042796

Gene Name

olfactory receptor 1032

Synonyms

GA_x6K02T2Q125-47485813-47486745, MOR199-1

MMRRC Submission

041084-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R4295 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86005540-86009125 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86008270 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 165 (Y165H)

Ref Sequence

ENSEMBL: ENSMUSP00000107216 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062166] [ENSMUST00000079298] [ENSMUST00000111589]

Predicted Effect

probably benign
Transcript: ENSMUST00000062166
AA Change: Y165H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000054494
Gene: ENSMUSG00000042796
AA Change: Y165H

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	306	5.6e-50	PFAM
Pfam:7tm_1	39	288	1.1e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000079298
AA Change: Y165H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000078279
Gene: ENSMUSG00000042796
AA Change: Y165H

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	306	1.3e-50	PFAM
Pfam:7tm_1	39	288	9.9e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111589
AA Change: Y165H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000107216
Gene: ENSMUSG00000042796
AA Change: Y165H

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	306	2.4e-50	PFAM
Pfam:7tm_1	39	288	3.5e-21	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	C	13: 119,469,713	S164P	probably benign	Het
4933427D06Rik	A	G	6: 89,107,901		noncoding transcript	Het
Aldh1l2	C	T	10: 83,495,920	V674M	possibly damaging	Het
Angel1	A	G	12: 86,720,283	Y440H	probably damaging	Het
Atr	A	G	9: 95,874,426	I870V	probably benign	Het
C330027C09Rik	T	A	16: 49,013,249	F571Y	probably benign	Het
Cd200r4	T	C	16: 44,832,876	V3A	probably damaging	Het
Celf2	T	C	2: 6,604,064	N302S	probably benign	Het
Dnah17	A	T	11: 118,118,772	I363N	probably damaging	Het
Fam98a	A	T	17: 75,541,347	M124K	probably damaging	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Foxj3	G	T	4: 119,626,297	G555*	probably null	Het
Gm4841	T	C	18: 60,270,190	N277S	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Kif18a	T	C	2: 109,293,053	V224A	probably benign	Het
Lamb2	A	G	9: 108,486,211	D863G	probably benign	Het
Lbr	C	T	1: 181,820,702	C398Y	probably damaging	Het
Lcn11	G	A	2: 25,778,099	A90T	possibly damaging	Het
Olfr1396	T	A	11: 49,113,427	I100L	probably benign	Het
Olfr310	A	T	7: 86,269,760	F10I	probably damaging	Het
Olfr460	T	A	6: 40,572,156	F257I	probably damaging	Het
Olfr926	A	G	9: 38,877,313	I46V	probably damaging	Het
Pcdhb5	T	A	18: 37,322,681	S705T	possibly damaging	Het
Pcgf2	A	T	11: 97,693,456	Y24*	probably null	Het
Phf14	C	T	6: 11,987,097	P559S	probably damaging	Het
Pigf	A	G	17: 87,023,756	I46T	probably benign	Het
Plpp4	A	G	7: 129,307,632	E22G	probably damaging	Het
Prdm10	A	G	9: 31,316,294	E65G	possibly damaging	Het
Sash1	A	G	10: 8,730,242	S795P	possibly damaging	Het
Slc22a21	T	C	11: 53,969,503	D34G	probably damaging	Het
Spata13	T	A	14: 60,709,555	M684K	probably damaging	Het
Srsf6	T	C	2: 162,934,716		probably benign	Het
Stk32c	T	C	7: 139,120,788		probably null	Het
Tjp1	T	C	7: 65,323,150	D514G	probably damaging	Het
Ttll11	TCGCCGCCGCCGCCGCCGCCGC	TCGCCGCCGCCGCCGCCGC	2: 35,979,552		probably benign	Het
Unc13c	A	G	9: 73,734,504	S1236P	probably damaging	Het
Utp20	G	T	10: 88,754,519	D2364E	possibly damaging	Het
Vmn1r192	T	A	13: 22,187,295	I252F	probably damaging	Het
Vmn1r76	T	C	7: 11,931,130	I52M	probably benign	Het
Xndc1	T	A	7: 102,081,487	L288M	possibly damaging	Het
Zfp451	A	T	1: 33,777,755	F154L	probably damaging	Het

Other mutations in Olfr1032

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Olfr1032	APN	2	86008547	missense	probably damaging	1.00
IGL03110:Olfr1032	APN	2	86008598	missense	probably damaging	0.99
IGL03167:Olfr1032	APN	2	86008167	nonsense	probably null
R0206:Olfr1032	UTSW	2	86008292	missense	probably damaging	1.00
R0206:Olfr1032	UTSW	2	86008292	missense	probably damaging	1.00
R0919:Olfr1032	UTSW	2	86008640	missense	possibly damaging	0.52
R2018:Olfr1032	UTSW	2	86008223	missense	probably damaging	1.00
R2019:Olfr1032	UTSW	2	86008223	missense	probably damaging	1.00
R2938:Olfr1032	UTSW	2	86008013	missense	probably damaging	0.97
R3843:Olfr1032	UTSW	2	86008204	missense	probably benign	0.09
R5813:Olfr1032	UTSW	2	86008292	missense	probably damaging	1.00
R6283:Olfr1032	UTSW	2	86008099	missense	possibly damaging	0.73
R7031:Olfr1032	UTSW	2	86008595	missense	probably benign	0.26
R7427:Olfr1032	UTSW	2	86008219	missense	probably benign	0.00
R7428:Olfr1032	UTSW	2	86008219	missense	probably benign	0.00
R7856:Olfr1032	UTSW	2	86008296	missense	probably damaging	0.99
R8048:Olfr1032	UTSW	2	86008180	missense	probably damaging	0.96
R8504:Olfr1032	UTSW	2	86007805	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGCTGCTTAGTACAGTGCTTC -3'
(R):5'- CGCATTCTGAGAATGGCAATGAG -3'

Sequencing Primer
(F):5'- GCCCTTGTTCATGTGGAAATC -3'
(R):5'- TTCTGAGAATGGCAATGAGAATGAAC -3'

Posted On

2015-06-20