Incidental Mutation 'R4295:Olfr1032'
ID323245
Institutional Source Beutler Lab
Gene Symbol Olfr1032
Ensembl Gene ENSMUSG00000042796
Gene Nameolfactory receptor 1032
SynonymsGA_x6K02T2Q125-47485813-47486745, MOR199-1
MMRRC Submission 041084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4295 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86005540-86009125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86008270 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 165 (Y165H)
Ref Sequence ENSEMBL: ENSMUSP00000107216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062166] [ENSMUST00000079298] [ENSMUST00000111589]
Predicted Effect probably benign
Transcript: ENSMUST00000062166
AA Change: Y165H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000054494
Gene: ENSMUSG00000042796
AA Change: Y165H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.6e-50 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079298
AA Change: Y165H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078279
Gene: ENSMUSG00000042796
AA Change: Y165H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-50 PFAM
Pfam:7tm_1 39 288 9.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111589
AA Change: Y165H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107216
Gene: ENSMUSG00000042796
AA Change: Y165H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-50 PFAM
Pfam:7tm_1 39 288 3.5e-21 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,713 S164P probably benign Het
4933427D06Rik A G 6: 89,107,901 noncoding transcript Het
Aldh1l2 C T 10: 83,495,920 V674M possibly damaging Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Atr A G 9: 95,874,426 I870V probably benign Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cd200r4 T C 16: 44,832,876 V3A probably damaging Het
Celf2 T C 2: 6,604,064 N302S probably benign Het
Dnah17 A T 11: 118,118,772 I363N probably damaging Het
Fam98a A T 17: 75,541,347 M124K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Foxj3 G T 4: 119,626,297 G555* probably null Het
Gm4841 T C 18: 60,270,190 N277S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lamb2 A G 9: 108,486,211 D863G probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lcn11 G A 2: 25,778,099 A90T possibly damaging Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr460 T A 6: 40,572,156 F257I probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Pcgf2 A T 11: 97,693,456 Y24* probably null Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pigf A G 17: 87,023,756 I46T probably benign Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Prdm10 A G 9: 31,316,294 E65G possibly damaging Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tjp1 T C 7: 65,323,150 D514G probably damaging Het
Ttll11 TCGCCGCCGCCGCCGCCGCCGC TCGCCGCCGCCGCCGCCGC 2: 35,979,552 probably benign Het
Unc13c A G 9: 73,734,504 S1236P probably damaging Het
Utp20 G T 10: 88,754,519 D2364E possibly damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn1r76 T C 7: 11,931,130 I52M probably benign Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfp451 A T 1: 33,777,755 F154L probably damaging Het
Other mutations in Olfr1032
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr1032 APN 2 86008547 missense probably damaging 1.00
IGL03110:Olfr1032 APN 2 86008598 missense probably damaging 0.99
IGL03167:Olfr1032 APN 2 86008167 nonsense probably null
R0206:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R0206:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R0919:Olfr1032 UTSW 2 86008640 missense possibly damaging 0.52
R2018:Olfr1032 UTSW 2 86008223 missense probably damaging 1.00
R2019:Olfr1032 UTSW 2 86008223 missense probably damaging 1.00
R2938:Olfr1032 UTSW 2 86008013 missense probably damaging 0.97
R3843:Olfr1032 UTSW 2 86008204 missense probably benign 0.09
R5813:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R6283:Olfr1032 UTSW 2 86008099 missense possibly damaging 0.73
R7031:Olfr1032 UTSW 2 86008595 missense probably benign 0.26
R7427:Olfr1032 UTSW 2 86008219 missense probably benign 0.00
R7428:Olfr1032 UTSW 2 86008219 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCTGCTTAGTACAGTGCTTC -3'
(R):5'- CGCATTCTGAGAATGGCAATGAG -3'

Sequencing Primer
(F):5'- GCCCTTGTTCATGTGGAAATC -3'
(R):5'- TTCTGAGAATGGCAATGAGAATGAAC -3'
Posted On2015-06-20