Incidental Mutation 'R4295:Foxj3'
ID323250
Institutional Source Beutler Lab
Gene Symbol Foxj3
Ensembl Gene ENSMUSG00000032998
Gene Nameforkhead box J3
SynonymsC330039G02Rik, Fhd6
MMRRC Submission 041084-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R4295 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location119537004-119629119 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 119626297 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 555 (G555*)
Ref Sequence ENSEMBL: ENSMUSP00000101917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044564] [ENSMUST00000106310]
Predicted Effect probably null
Transcript: ENSMUST00000044564
AA Change: G589*
SMART Domains Protein: ENSMUSP00000035746
Gene: ENSMUSG00000032998
AA Change: G589*

DomainStartEndE-ValueType
FH 76 164 6.03e-50 SMART
low complexity region 226 239 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 317 346 N/A INTRINSIC
low complexity region 372 434 N/A INTRINSIC
low complexity region 611 620 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106310
AA Change: G555*
SMART Domains Protein: ENSMUSP00000101917
Gene: ENSMUSG00000032998
AA Change: G555*

DomainStartEndE-ValueType
FH 76 164 6.03e-50 SMART
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 283 312 N/A INTRINSIC
low complexity region 338 400 N/A INTRINSIC
low complexity region 577 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133097
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have an abnormal skeletal muscle fiber type ratio in males as well as defects in muscle regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,713 S164P probably benign Het
4933427D06Rik A G 6: 89,107,901 noncoding transcript Het
Aldh1l2 C T 10: 83,495,920 V674M possibly damaging Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Atr A G 9: 95,874,426 I870V probably benign Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cd200r4 T C 16: 44,832,876 V3A probably damaging Het
Celf2 T C 2: 6,604,064 N302S probably benign Het
Dnah17 A T 11: 118,118,772 I363N probably damaging Het
Fam98a A T 17: 75,541,347 M124K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm4841 T C 18: 60,270,190 N277S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lamb2 A G 9: 108,486,211 D863G probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lcn11 G A 2: 25,778,099 A90T possibly damaging Het
Olfr1032 T C 2: 86,008,270 Y165H probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr460 T A 6: 40,572,156 F257I probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Pcgf2 A T 11: 97,693,456 Y24* probably null Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pigf A G 17: 87,023,756 I46T probably benign Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Prdm10 A G 9: 31,316,294 E65G possibly damaging Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tjp1 T C 7: 65,323,150 D514G probably damaging Het
Ttll11 TCGCCGCCGCCGCCGCCGCCGC TCGCCGCCGCCGCCGCCGC 2: 35,979,552 probably benign Het
Unc13c A G 9: 73,734,504 S1236P probably damaging Het
Utp20 G T 10: 88,754,519 D2364E possibly damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn1r76 T C 7: 11,931,130 I52M probably benign Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfp451 A T 1: 33,777,755 F154L probably damaging Het
Other mutations in Foxj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Foxj3 APN 4 119610029 missense probably benign 0.03
IGL01452:Foxj3 APN 4 119621628 missense unknown
IGL02056:Foxj3 APN 4 119585757 missense probably damaging 1.00
IGL02455:Foxj3 APN 4 119620237 missense unknown
IGL02542:Foxj3 APN 4 119620343 missense unknown
IGL02625:Foxj3 APN 4 119624917 missense unknown
IGL03216:Foxj3 APN 4 119609983 intron probably benign
R0087:Foxj3 UTSW 4 119626400 missense unknown
R0488:Foxj3 UTSW 4 119619990 nonsense probably null
R0512:Foxj3 UTSW 4 119585836 splice site probably benign
R1531:Foxj3 UTSW 4 119620201 missense unknown
R1799:Foxj3 UTSW 4 119619351 missense probably benign 0.06
R1883:Foxj3 UTSW 4 119610029 missense probably benign 0.20
R3690:Foxj3 UTSW 4 119616642 splice site probably benign
R3691:Foxj3 UTSW 4 119616642 splice site probably benign
R3838:Foxj3 UTSW 4 119616624 missense possibly damaging 0.49
R4065:Foxj3 UTSW 4 119610009 missense probably benign 0.09
R4576:Foxj3 UTSW 4 119621663 missense unknown
R4750:Foxj3 UTSW 4 119616590 missense probably damaging 0.99
R4782:Foxj3 UTSW 4 119621660 missense unknown
R4799:Foxj3 UTSW 4 119621660 missense unknown
R5305:Foxj3 UTSW 4 119619958 missense possibly damaging 0.73
R5358:Foxj3 UTSW 4 119619399 missense probably damaging 1.00
R5362:Foxj3 UTSW 4 119620143 missense unknown
R5728:Foxj3 UTSW 4 119573762 missense probably damaging 1.00
R5732:Foxj3 UTSW 4 119585811 missense probably damaging 1.00
R6151:Foxj3 UTSW 4 119623271 missense unknown
R6352:Foxj3 UTSW 4 119585778 missense probably damaging 1.00
R6377:Foxj3 UTSW 4 119573748 unclassified probably null
R7034:Foxj3 UTSW 4 119619300 missense probably damaging 0.97
R7672:Foxj3 UTSW 4 119620232 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCCTACTATAAAATAAGGACCAGAGG -3'
(R):5'- ACCCAGCTAGAATCTCTGATTGTC -3'

Sequencing Primer
(F):5'- TATAAAATAAGGACCAGAGGAACCAC -3'
(R):5'- GAATCTCTGATTGTCTTCGAAAGG -3'
Posted On2015-06-20