Incidental Mutation 'R4295:Olfr460'
ID323252
Institutional Source Beutler Lab
Gene Symbol Olfr460
Ensembl Gene ENSMUSG00000045514
Gene Nameolfactory receptor 460
SynonymsGA_x6K02T2P3E9-6947292-6946348, MOR120-2
MMRRC Submission 041084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4295 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location40569487-40574343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40572156 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 257 (F257I)
Ref Sequence ENSEMBL: ENSMUSP00000151187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051540] [ENSMUST00000101491] [ENSMUST00000216942]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031975
Predicted Effect probably damaging
Transcript: ENSMUST00000051540
AA Change: F257I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054887
Gene: ENSMUSG00000045514
AA Change: F257I

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 3e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 296 3e-5 PFAM
Pfam:7tm_1 40 290 2.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101491
SMART Domains Protein: ENSMUSP00000099030
Gene: ENSMUSG00000029915

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
CLECT 48 161 3.83e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000216942
AA Change: F257I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,713 S164P probably benign Het
4933427D06Rik A G 6: 89,107,901 noncoding transcript Het
Aldh1l2 C T 10: 83,495,920 V674M possibly damaging Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Atr A G 9: 95,874,426 I870V probably benign Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cd200r4 T C 16: 44,832,876 V3A probably damaging Het
Celf2 T C 2: 6,604,064 N302S probably benign Het
Dnah17 A T 11: 118,118,772 I363N probably damaging Het
Fam98a A T 17: 75,541,347 M124K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Foxj3 G T 4: 119,626,297 G555* probably null Het
Gm4841 T C 18: 60,270,190 N277S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lamb2 A G 9: 108,486,211 D863G probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lcn11 G A 2: 25,778,099 A90T possibly damaging Het
Olfr1032 T C 2: 86,008,270 Y165H probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Pcgf2 A T 11: 97,693,456 Y24* probably null Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pigf A G 17: 87,023,756 I46T probably benign Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Prdm10 A G 9: 31,316,294 E65G possibly damaging Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tjp1 T C 7: 65,323,150 D514G probably damaging Het
Ttll11 TCGCCGCCGCCGCCGCCGCCGC TCGCCGCCGCCGCCGCCGC 2: 35,979,552 probably benign Het
Unc13c A G 9: 73,734,504 S1236P probably damaging Het
Utp20 G T 10: 88,754,519 D2364E possibly damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn1r76 T C 7: 11,931,130 I52M probably benign Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfp451 A T 1: 33,777,755 F154L probably damaging Het
Other mutations in Olfr460
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Olfr460 APN 6 40571454 missense probably benign 0.01
IGL01599:Olfr460 APN 6 40572252 missense probably damaging 0.99
IGL02168:Olfr460 APN 6 40571383 utr 5 prime probably benign
PIT4280001:Olfr460 UTSW 6 40571716 missense probably damaging 0.98
R0964:Olfr460 UTSW 6 40572205 missense probably benign 0.06
R1446:Olfr460 UTSW 6 40571899 missense probably benign 0.06
R2925:Olfr460 UTSW 6 40571408 missense probably benign 0.00
R4382:Olfr460 UTSW 6 40572064 missense probably damaging 1.00
R7432:Olfr460 UTSW 6 40572306 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGAGGCCAGTTGCTCAAATTATC -3'
(R):5'- TCTTGAAGAAGTGGTAGCAGC -3'

Sequencing Primer
(F):5'- AGTTTATCCTTTTTCTAATGGCAGTC -3'
(R):5'- AAGTGGTAGCAGCGTTTCACTC -3'
Posted On2015-06-20