Incidental Mutation 'R4295:Olfr310'
ID323258
Institutional Source Beutler Lab
Gene Symbol Olfr310
Ensembl Gene ENSMUSG00000057540
Gene Nameolfactory receptor 310
SynonymsGA_x6K02T2NHDJ-9838699-9839697, MOR227-6P
MMRRC Submission 041084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4295 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86268487-86277172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86269760 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 10 (F10I)
Ref Sequence ENSEMBL: ENSMUSP00000151989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081918] [ENSMUST00000217724]
Predicted Effect probably damaging
Transcript: ENSMUST00000081918
AA Change: F10I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080589
Gene: ENSMUSG00000057540
AA Change: F10I

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 8.9e-46 PFAM
Pfam:7tm_1 39 289 1.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217724
AA Change: F10I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4674 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,713 S164P probably benign Het
4933427D06Rik A G 6: 89,107,901 noncoding transcript Het
Aldh1l2 C T 10: 83,495,920 V674M possibly damaging Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Atr A G 9: 95,874,426 I870V probably benign Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cd200r4 T C 16: 44,832,876 V3A probably damaging Het
Celf2 T C 2: 6,604,064 N302S probably benign Het
Dnah17 A T 11: 118,118,772 I363N probably damaging Het
Fam98a A T 17: 75,541,347 M124K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Foxj3 G T 4: 119,626,297 G555* probably null Het
Gm4841 T C 18: 60,270,190 N277S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lamb2 A G 9: 108,486,211 D863G probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lcn11 G A 2: 25,778,099 A90T possibly damaging Het
Olfr1032 T C 2: 86,008,270 Y165H probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr460 T A 6: 40,572,156 F257I probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Pcgf2 A T 11: 97,693,456 Y24* probably null Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pigf A G 17: 87,023,756 I46T probably benign Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Prdm10 A G 9: 31,316,294 E65G possibly damaging Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tjp1 T C 7: 65,323,150 D514G probably damaging Het
Ttll11 TCGCCGCCGCCGCCGCCGCCGC TCGCCGCCGCCGCCGCCGC 2: 35,979,552 probably benign Het
Unc13c A G 9: 73,734,504 S1236P probably damaging Het
Utp20 G T 10: 88,754,519 D2364E possibly damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn1r76 T C 7: 11,931,130 I52M probably benign Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfp451 A T 1: 33,777,755 F154L probably damaging Het
Other mutations in Olfr310
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Olfr310 APN 7 86269669 missense probably damaging 1.00
IGL00917:Olfr310 APN 7 86269441 missense probably damaging 1.00
IGL02145:Olfr310 APN 7 86269258 missense probably damaging 1.00
IGL02639:Olfr310 APN 7 86269720 missense probably damaging 0.99
R0139:Olfr310 UTSW 7 86268979 missense probably benign 0.00
R0554:Olfr310 UTSW 7 86269657 missense probably damaging 0.99
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1474:Olfr310 UTSW 7 86269062 missense probably damaging 1.00
R2379:Olfr310 UTSW 7 86269649 missense probably damaging 1.00
R3692:Olfr310 UTSW 7 86269495 missense probably damaging 1.00
R4290:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4291:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R5071:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5072:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5074:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5828:Olfr310 UTSW 7 86269520 missense probably benign 0.00
R6174:Olfr310 UTSW 7 86268801 missense probably benign
R6207:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R6493:Olfr310 UTSW 7 86268882 missense probably benign 0.21
R7068:Olfr310 UTSW 7 86269537 missense probably damaging 1.00
R7196:Olfr310 UTSW 7 86269441 missense probably damaging 1.00
R7694:Olfr310 UTSW 7 86269775 missense probably damaging 1.00
R7794:Olfr310 UTSW 7 86269133 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTAAAATGGACAGATTCCTGAGG -3'
(R):5'- TGGACAGATAGGTATAACTCTGTG -3'

Sequencing Primer
(F):5'- TTCCTGAGGAAGAAGTACATGG -3'
(R):5'- ATTAAGTTATTCCTTGTCC -3'
Posted On2015-06-20