Incidental Mutation 'R0003:Wdr11'
Institutional Source Beutler Lab
Gene Symbol Wdr11
Ensembl Gene ENSMUSG00000042055
Gene NameWD repeat domain 11
SynonymsBrwd2, Wdr11
MMRRC Submission 038299-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R0003 (G1)
Quality Score225
Status Validated
Chromosomal Location129591863-129635738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 129599061 bp
Amino Acid Change Glycine to Cysteine at position 79 (G79C)
Ref Sequence ENSEMBL: ENSMUSP00000081567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084519]
Predicted Effect probably damaging
Transcript: ENSMUST00000084519
AA Change: G79C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081567
Gene: ENSMUSG00000042055
AA Change: G79C

WD40 50 99 2e-1 SMART
WD40 102 145 2.84e2 SMART
low complexity region 189 200 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 454 465 N/A INTRINSIC
WD40 552 595 4.42e1 SMART
WD40 696 735 1.66e0 SMART
WD40 737 777 1.43e1 SMART
WD40 780 821 1.38e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143422
Predicted Effect unknown
Transcript: ENSMUST00000148752
AA Change: G19C
Meta Mutation Damage Score 0.2009 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is located in the chromosome 10q25-26 region, which is frequently deleted in gliomas and tumors of other tissues, and is disrupted by the t(10;19) translocation rearrangement in glioblastoma cells. The gene location suggests that it is a candidate gene for the tumor suppressor locus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,578 V1903E possibly damaging Het
Adam19 T A 11: 46,128,789 C439S probably damaging Het
Adnp2 T C 18: 80,130,990 Y68C probably damaging Het
Ahctf1 A T 1: 179,763,473 D1247E probably benign Het
Alms1 T A 6: 85,629,210 M2614K possibly damaging Het
Alx3 A G 3: 107,604,976 H310R probably damaging Het
Ambra1 C T 2: 91,911,428 T1016M probably damaging Het
Ankrd35 A G 3: 96,684,015 E539G probably damaging Het
Aptx A G 4: 40,695,145 probably benign Het
Arsi C T 18: 60,916,986 R314C probably benign Het
Atp1a3 T C 7: 24,989,564 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
BC067074 T A 13: 113,368,776 S2146R probably benign Het
Bicra G T 7: 15,971,887 T1543K probably benign Het
Bzw2 A C 12: 36,130,015 I71S probably damaging Het
Camk2a C T 18: 60,960,007 A302V probably damaging Het
Ccdc12 A G 9: 110,656,597 E12G possibly damaging Het
Cd300lb A T 11: 114,928,338 F19Y probably benign Het
Clcn3 A T 8: 60,927,296 C535* probably null Het
Cntnap5c A G 17: 58,199,017 T679A probably benign Het
Cpsf7 G A 19: 10,539,629 S365N possibly damaging Het
Cyp20a1 T C 1: 60,387,126 probably benign Het
Decr2 A T 17: 26,083,053 N234K probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dnah12 T C 14: 26,772,644 F1300L probably damaging Het
Dock1 T C 7: 134,730,064 probably benign Het
Dpy19l4 A T 4: 11,267,619 N440K probably damaging Het
Eprs T C 1: 185,414,391 V1206A probably damaging Het
Exoc6b A G 6: 84,854,699 probably null Het
Fam184b A G 5: 45,555,194 probably benign Het
Fcho1 A T 8: 71,708,953 S858T probably damaging Het
Fgfr1 A G 8: 25,568,198 D430G possibly damaging Het
Fmnl3 T C 15: 99,321,132 T807A probably damaging Het
Gabra5 T C 7: 57,413,728 Y316C probably damaging Het
Gh A G 11: 106,301,520 L16P probably damaging Het
Glipr2 A T 4: 43,970,532 I87F probably damaging Het
Glrb T A 3: 80,855,914 I259F probably damaging Het
Gpr63 T C 4: 25,007,651 L125P probably damaging Het
Grb2 A G 11: 115,655,425 Y37H probably damaging Het
Haus2 G A 2: 120,618,968 probably benign Het
Hmgcr T C 13: 96,652,145 N749S probably damaging Het
Igf1r T C 7: 68,165,242 V297A probably damaging Het
Il12rb2 G T 6: 67,316,286 P69H probably damaging Het
Ints3 C A 3: 90,408,511 M315I probably benign Het
Izumo2 C T 7: 44,715,409 T116I probably benign Het
Kctd19 A C 8: 105,395,361 Y185D probably damaging Het
Lama4 A G 10: 39,060,222 N631S possibly damaging Het
Lama5 T G 2: 180,178,079 probably null Het
Lamc1 A C 1: 153,262,439 L223R probably damaging Het
Lgr4 G A 2: 109,997,665 probably null Het
Loxhd1 T C 18: 77,339,500 L398P probably damaging Het
Mapk9 T A 11: 49,867,039 D103E possibly damaging Het
March6 T C 15: 31,469,532 probably benign Het
Mlxipl G A 5: 135,133,189 probably benign Het
Mrgbp C A 2: 180,583,438 D62E probably benign Het
Mtap A T 4: 89,151,998 probably benign Het
Myt1 G A 2: 181,801,871 G497S probably damaging Het
Naa25 T G 5: 121,407,184 probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkpd1 T C 7: 19,519,927 C73R probably benign Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Nvl C A 1: 181,114,133 D581Y probably damaging Het
Olfr1102 T A 2: 87,002,366 Y132* probably null Het
Olfr1500 T C 19: 13,827,686 T237A probably damaging Het
Olfr568 T C 7: 102,877,861 V247A probably benign Het
Olfr575 T C 7: 102,954,978 M208V probably benign Het
Olfr905 A G 9: 38,473,316 T190A probably benign Het
Pcdh7 G T 5: 57,913,248 E1089D probably benign Het
Pik3cd A G 4: 149,656,379 probably null Het
Plekhh2 A T 17: 84,557,392 K69N probably damaging Het
Ptgdr2 G A 19: 10,940,428 C103Y probably damaging Het
Rrad A C 8: 104,628,667 H236Q probably benign Het
Rslcan18 C T 13: 67,098,469 A236T probably benign Het
Ryr2 C A 13: 11,824,379 D503Y probably damaging Het
Siglec1 T C 2: 131,075,060 T1092A probably benign Het
Siglecf A G 7: 43,355,926 T437A probably benign Het
Spta1 A T 1: 174,205,273 Q965H probably damaging Het
Stk10 A T 11: 32,589,460 E280V probably benign Het
Tfg T C 16: 56,690,988 Y326C possibly damaging Het
Tpp2 T A 1: 43,960,139 S358T possibly damaging Het
Trim25 G T 11: 89,015,772 V437L probably benign Het
Ttn T C 2: 76,743,683 D25622G probably damaging Het
Ube3b T A 5: 114,398,851 S303R probably benign Het
Ush2a T A 1: 188,578,491 V2088D probably damaging Het
Vmn2r103 A G 17: 19,811,979 T672A probably damaging Het
Wdr89 T A 12: 75,632,593 T296S probably benign Het
Zdhhc24 T A 19: 4,880,374 L179M possibly damaging Het
Zfp981 T C 4: 146,537,760 C381R probably damaging Het
Zim1 A G 7: 6,676,948 I572T probably benign Het
Other mutations in Wdr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Wdr11 APN 7 129593093 splice site probably null
IGL01121:Wdr11 APN 7 129628022 missense probably benign 0.02
IGL01385:Wdr11 APN 7 129607913 missense probably benign
IGL01923:Wdr11 APN 7 129632322 critical splice acceptor site probably null
IGL02274:Wdr11 APN 7 129631172 critical splice acceptor site probably null
IGL02894:Wdr11 APN 7 129631166 splice site probably benign
IGL02927:Wdr11 APN 7 129607098 critical splice donor site probably null
IGL03008:Wdr11 APN 7 129606991 unclassified probably benign
IGL03026:Wdr11 APN 7 129624336 missense probably damaging 1.00
IGL03354:Wdr11 APN 7 129625302 missense probably benign 0.01
IGL03379:Wdr11 APN 7 129599123 missense probably damaging 1.00
Propeller UTSW 7 129606675 missense possibly damaging 0.91
R0928:Wdr11 UTSW 7 129606653 missense probably damaging 1.00
R1170:Wdr11 UTSW 7 129607107 unclassified probably benign
R1645:Wdr11 UTSW 7 129613889 missense probably benign 0.29
R1908:Wdr11 UTSW 7 129605230 missense possibly damaging 0.60
R1938:Wdr11 UTSW 7 129606607 missense probably benign 0.08
R2122:Wdr11 UTSW 7 129631766 missense probably damaging 1.00
R2148:Wdr11 UTSW 7 129629083 splice site probably null
R2240:Wdr11 UTSW 7 129605694 critical splice acceptor site probably null
R2362:Wdr11 UTSW 7 129634836 missense probably benign 0.05
R3774:Wdr11 UTSW 7 129631693 splice site probably null
R4297:Wdr11 UTSW 7 129625186 missense probably benign 0.18
R4546:Wdr11 UTSW 7 129629005 missense probably damaging 1.00
R4787:Wdr11 UTSW 7 129608934 splice site probably benign
R4789:Wdr11 UTSW 7 129618670 nonsense probably null
R4807:Wdr11 UTSW 7 129628022 missense probably benign 0.02
R4855:Wdr11 UTSW 7 129600434 splice site probably null
R4898:Wdr11 UTSW 7 129633721 missense probably benign
R5022:Wdr11 UTSW 7 129624711 missense probably benign 0.10
R5326:Wdr11 UTSW 7 129625249 missense probably damaging 1.00
R5398:Wdr11 UTSW 7 129631232 missense probably damaging 1.00
R6120:Wdr11 UTSW 7 129624791 missense probably damaging 0.99
R6136:Wdr11 UTSW 7 129618703 missense possibly damaging 0.86
R6280:Wdr11 UTSW 7 129599106 nonsense probably null
R6352:Wdr11 UTSW 7 129606675 missense possibly damaging 0.91
R6432:Wdr11 UTSW 7 129606518 missense possibly damaging 0.83
R6766:Wdr11 UTSW 7 129624312 missense probably benign 0.02
R6911:Wdr11 UTSW 7 129607095 missense probably benign 0.28
R7135:Wdr11 UTSW 7 129628106 missense possibly damaging 0.76
R7151:Wdr11 UTSW 7 129606652 missense probably damaging 1.00
R7463:Wdr11 UTSW 7 129607086 missense probably damaging 0.99
R7503:Wdr11 UTSW 7 129603110 missense probably benign
R8097:Wdr11 UTSW 7 129607887 missense probably damaging 1.00
R8254:Wdr11 UTSW 7 129634836 missense probably benign 0.02
R8354:Wdr11 UTSW 7 129602999 missense probably damaging 0.99
R8377:Wdr11 UTSW 7 129606688 missense possibly damaging 0.56
R8416:Wdr11 UTSW 7 129630679 missense possibly damaging 0.62
R8708:Wdr11 UTSW 7 129599056 missense probably benign 0.07
Z1177:Wdr11 UTSW 7 129607878 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cgaaaaaccaaagaaagaaaagaaag -3'
Posted On2013-05-09