Incidental Mutation 'R4295:Sash1'
ID323270
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
MMRRC Submission 041084-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4295 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8730242 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 795 (S795P)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015449
AA Change: S795P

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: S795P

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,713 S164P probably benign Het
4933427D06Rik A G 6: 89,107,901 noncoding transcript Het
Aldh1l2 C T 10: 83,495,920 V674M possibly damaging Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Atr A G 9: 95,874,426 I870V probably benign Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cd200r4 T C 16: 44,832,876 V3A probably damaging Het
Celf2 T C 2: 6,604,064 N302S probably benign Het
Dnah17 A T 11: 118,118,772 I363N probably damaging Het
Fam98a A T 17: 75,541,347 M124K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Foxj3 G T 4: 119,626,297 G555* probably null Het
Gm4841 T C 18: 60,270,190 N277S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lamb2 A G 9: 108,486,211 D863G probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lcn11 G A 2: 25,778,099 A90T possibly damaging Het
Olfr1032 T C 2: 86,008,270 Y165H probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr460 T A 6: 40,572,156 F257I probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Pcgf2 A T 11: 97,693,456 Y24* probably null Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pigf A G 17: 87,023,756 I46T probably benign Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Prdm10 A G 9: 31,316,294 E65G possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tjp1 T C 7: 65,323,150 D514G probably damaging Het
Ttll11 TCGCCGCCGCCGCCGCCGCCGC TCGCCGCCGCCGCCGCCGC 2: 35,979,552 probably benign Het
Unc13c A G 9: 73,734,504 S1236P probably damaging Het
Utp20 G T 10: 88,754,519 D2364E possibly damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn1r76 T C 7: 11,931,130 I52M probably benign Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfp451 A T 1: 33,777,755 F154L probably damaging Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
R7752:Sash1 UTSW 10 8780564 nonsense probably null
R7856:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7901:Sash1 UTSW 10 8780564 nonsense probably null
R7939:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7984:Sash1 UTSW 10 8780564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATCTGCTGTGGGATCTCG -3'
(R):5'- AACCCAGCGTTCTGTCTAC -3'

Sequencing Primer
(F):5'- GGCACTTCTGGTACATTCTGAGAAC -3'
(R):5'- AGCGTTCTGTCTACCAAGTCG -3'
Posted On2015-06-20