Mutagenetix > Incidental Mutation

Incidental Mutation 'R4295:Aldh1l2'

323271

Institutional Source

Beutler Lab

Gene Symbol

Aldh1l2

Ensembl Gene

ENSMUSG00000020256

Gene Name

aldehyde dehydrogenase 1 family, member L2

Synonyms

MMRRC Submission

041084-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4295 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83487450-83534140 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83495920 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 674 (V674M)

Ref Sequence

ENSEMBL: ENSMUSP00000117076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]

AlphaFold

Q8K009

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020497
AA Change: V787M

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: V787M

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	23	202	5e-46	PFAM
Pfam:Formyl_trans_C	226	330	1.3e-16	PFAM
Pfam:PP-binding	346	412	9.6e-7	PFAM
Pfam:Aldedh	451	919	3.4e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141184

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143793

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146640
AA Change: V674M

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: V674M

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	1	89	2.8e-30	PFAM
Pfam:Formyl_trans_C	113	217	1.1e-16	PFAM
Pfam:PP-binding	233	299	1.5e-8	PFAM
Pfam:Aldedh	338	806	8.5e-175	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147381

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	C	13: 119,469,713	S164P	probably benign	Het
4933427D06Rik	A	G	6: 89,107,901		noncoding transcript	Het
Angel1	A	G	12: 86,720,283	Y440H	probably damaging	Het
Atr	A	G	9: 95,874,426	I870V	probably benign	Het
C330027C09Rik	T	A	16: 49,013,249	F571Y	probably benign	Het
Cd200r4	T	C	16: 44,832,876	V3A	probably damaging	Het
Celf2	T	C	2: 6,604,064	N302S	probably benign	Het
Dnah17	A	T	11: 118,118,772	I363N	probably damaging	Het
Fam98a	A	T	17: 75,541,347	M124K	probably damaging	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Foxj3	G	T	4: 119,626,297	G555*	probably null	Het
Gm4841	T	C	18: 60,270,190	N277S	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Kif18a	T	C	2: 109,293,053	V224A	probably benign	Het
Lamb2	A	G	9: 108,486,211	D863G	probably benign	Het
Lbr	C	T	1: 181,820,702	C398Y	probably damaging	Het
Lcn11	G	A	2: 25,778,099	A90T	possibly damaging	Het
Olfr1032	T	C	2: 86,008,270	Y165H	probably benign	Het
Olfr1396	T	A	11: 49,113,427	I100L	probably benign	Het
Olfr310	A	T	7: 86,269,760	F10I	probably damaging	Het
Olfr460	T	A	6: 40,572,156	F257I	probably damaging	Het
Olfr926	A	G	9: 38,877,313	I46V	probably damaging	Het
Pcdhb5	T	A	18: 37,322,681	S705T	possibly damaging	Het
Pcgf2	A	T	11: 97,693,456	Y24*	probably null	Het
Phf14	C	T	6: 11,987,097	P559S	probably damaging	Het
Pigf	A	G	17: 87,023,756	I46T	probably benign	Het
Plpp4	A	G	7: 129,307,632	E22G	probably damaging	Het
Prdm10	A	G	9: 31,316,294	E65G	possibly damaging	Het
Sash1	A	G	10: 8,730,242	S795P	possibly damaging	Het
Slc22a21	T	C	11: 53,969,503	D34G	probably damaging	Het
Spata13	T	A	14: 60,709,555	M684K	probably damaging	Het
Srsf6	T	C	2: 162,934,716		probably benign	Het
Stk32c	T	C	7: 139,120,788		probably null	Het
Tjp1	T	C	7: 65,323,150	D514G	probably damaging	Het
Ttll11	TCGCCGCCGCCGCCGCCGCCGC	TCGCCGCCGCCGCCGCCGC	2: 35,979,552		probably benign	Het
Unc13c	A	G	9: 73,734,504	S1236P	probably damaging	Het
Utp20	G	T	10: 88,754,519	D2364E	possibly damaging	Het
Vmn1r192	T	A	13: 22,187,295	I252F	probably damaging	Het
Vmn1r76	T	C	7: 11,931,130	I52M	probably benign	Het
Xndc1	T	A	7: 102,081,487	L288M	possibly damaging	Het
Zfp451	A	T	1: 33,777,755	F154L	probably damaging	Het

Other mutations in Aldh1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Aldh1l2	APN	10	83522886	nonsense	probably null
IGL01154:Aldh1l2	APN	10	83520373	missense	probably damaging	1.00
IGL01301:Aldh1l2	APN	10	83522846	missense	probably damaging	1.00
IGL01354:Aldh1l2	APN	10	83527376	missense	probably damaging	1.00
IGL01364:Aldh1l2	APN	10	83492667	missense	probably damaging	1.00
IGL01445:Aldh1l2	APN	10	83520262	splice site	probably benign
IGL02179:Aldh1l2	APN	10	83522837	missense	probably benign	0.10
IGL02283:Aldh1l2	APN	10	83495895	missense	probably benign	0.00
IGL02507:Aldh1l2	APN	10	83492584	nonsense	probably null
IGL02727:Aldh1l2	APN	10	83506605	missense	probably damaging	1.00
IGL03353:Aldh1l2	APN	10	83522913	missense	probably benign	0.17
Hunger_winter	UTSW	10	83508013	critical splice donor site	probably null
Spartan	UTSW	10	83512306	missense	possibly damaging	0.93
ANU18:Aldh1l2	UTSW	10	83522846	missense	probably damaging	1.00
IGL02984:Aldh1l2	UTSW	10	83527335	missense	probably damaging	1.00
R0267:Aldh1l2	UTSW	10	83522687	splice site	probably benign
R0302:Aldh1l2	UTSW	10	83520365	missense	probably damaging	1.00
R0349:Aldh1l2	UTSW	10	83490614	missense	probably damaging	1.00
R0468:Aldh1l2	UTSW	10	83518678	missense	probably benign	0.01
R0745:Aldh1l2	UTSW	10	83518630	splice site	probably null
R0788:Aldh1l2	UTSW	10	83516164	missense	probably damaging	1.00
R1117:Aldh1l2	UTSW	10	83508623	missense	probably benign	0.01
R1241:Aldh1l2	UTSW	10	83496025	missense	probably benign	0.00
R1420:Aldh1l2	UTSW	10	83495935	missense	probably damaging	1.00
R1490:Aldh1l2	UTSW	10	83520370	missense	probably damaging	1.00
R1704:Aldh1l2	UTSW	10	83508660	missense	probably benign	0.10
R1729:Aldh1l2	UTSW	10	83508082	nonsense	probably null
R1893:Aldh1l2	UTSW	10	83492536	missense	probably damaging	1.00
R1897:Aldh1l2	UTSW	10	83502525	missense	probably damaging	1.00
R2047:Aldh1l2	UTSW	10	83506743	missense	probably damaging	1.00
R2290:Aldh1l2	UTSW	10	83527313	missense	probably damaging	1.00
R3054:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R3055:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R4097:Aldh1l2	UTSW	10	83512364	missense	probably damaging	0.98
R4162:Aldh1l2	UTSW	10	83506654	missense	possibly damaging	0.50
R4296:Aldh1l2	UTSW	10	83522777	missense	probably benign	0.34
R4388:Aldh1l2	UTSW	10	83513622	missense	probably damaging	1.00
R4809:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R5052:Aldh1l2	UTSW	10	83508692	missense	possibly damaging	0.92
R5421:Aldh1l2	UTSW	10	83527407	missense	probably damaging	1.00
R5491:Aldh1l2	UTSW	10	83522785	missense	probably benign	0.00
R5688:Aldh1l2	UTSW	10	83501925	missense	possibly damaging	0.93
R5726:Aldh1l2	UTSW	10	83512306	missense	possibly damaging	0.93
R5737:Aldh1l2	UTSW	10	83520325	missense	probably damaging	1.00
R5752:Aldh1l2	UTSW	10	83520380	missense	probably damaging	1.00
R6113:Aldh1l2	UTSW	10	83508134	nonsense	probably null
R6161:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R6166:Aldh1l2	UTSW	10	83493424	splice site	probably null
R6189:Aldh1l2	UTSW	10	83508013	critical splice donor site	probably null
R7357:Aldh1l2	UTSW	10	83514544	missense	possibly damaging	0.89
R7394:Aldh1l2	UTSW	10	83502457	missense	probably damaging	1.00
R7469:Aldh1l2	UTSW	10	83508105	missense	probably damaging	1.00
R7676:Aldh1l2	UTSW	10	83508111	missense	probably benign
R7848:Aldh1l2	UTSW	10	83499843	missense	probably benign	0.12
R7958:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R8311:Aldh1l2	UTSW	10	83490615	missense	probably damaging	1.00
R8477:Aldh1l2	UTSW	10	83501921	missense	probably damaging	1.00
R8730:Aldh1l2	UTSW	10	83506642	missense	possibly damaging	0.94
R8884:Aldh1l2	UTSW	10	83508677	missense	probably benign	0.02
R9117:Aldh1l2	UTSW	10	83506681	missense	probably benign	0.41
R9239:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R9335:Aldh1l2	UTSW	10	83506646	missense	probably damaging	0.96
R9368:Aldh1l2	UTSW	10	83495952	nonsense	probably null
R9784:Aldh1l2	UTSW	10	83506750	critical splice acceptor site	probably null
Z1177:Aldh1l2	UTSW	10	83493480	missense	probably damaging	1.00
Z1177:Aldh1l2	UTSW	10	83534005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTTGTCATGTTATAAATACCACTTGG -3'
(R):5'- CCAGGAGCATCCACTTTCATGA -3'

Sequencing Primer
(F):5'- AGCCAGTATTCTGCTAGCAG -3'
(R):5'- CCACTTTCATGACTAAAGGCAGGTG -3'

Posted On

2015-06-20