Incidental Mutation 'R4295:Aldh1l2'
ID 323271
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms D330038I09Rik
MMRRC Submission 041084-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4295 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 83323314-83370004 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 83331784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 674 (V674M)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect possibly damaging
Transcript: ENSMUST00000020497
AA Change: V787M

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: V787M

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143793
Predicted Effect possibly damaging
Transcript: ENSMUST00000146640
AA Change: V674M

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: V674M

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147381
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,606,249 (GRCm39) S164P probably benign Het
4933427D06Rik A G 6: 89,084,883 (GRCm39) noncoding transcript Het
Angel1 A G 12: 86,767,057 (GRCm39) Y440H probably damaging Het
Atr A G 9: 95,756,479 (GRCm39) I870V probably benign Het
Cd200r4 T C 16: 44,653,239 (GRCm39) V3A probably damaging Het
Celf2 T C 2: 6,608,875 (GRCm39) N302S probably benign Het
Cip2a T A 16: 48,833,612 (GRCm39) F571Y probably benign Het
Dnah17 A T 11: 118,009,598 (GRCm39) I363N probably damaging Het
Fam98a A T 17: 75,848,342 (GRCm39) M124K probably damaging Het
Fhdc1 C A 3: 84,352,133 (GRCm39) V1031F probably benign Het
Foxj3 G T 4: 119,483,494 (GRCm39) G555* probably null Het
Gm4841 T C 18: 60,403,262 (GRCm39) N277S probably benign Het
Kcnv1 G A 15: 44,977,840 (GRCm39) T66M probably damaging Het
Kif18a T C 2: 109,123,398 (GRCm39) V224A probably benign Het
Lamb2 A G 9: 108,363,410 (GRCm39) D863G probably benign Het
Lbr C T 1: 181,648,267 (GRCm39) C398Y probably damaging Het
Lcn11 G A 2: 25,668,111 (GRCm39) A90T possibly damaging Het
Or14c46 A T 7: 85,918,968 (GRCm39) F10I probably damaging Het
Or2v2 T A 11: 49,004,254 (GRCm39) I100L probably benign Het
Or5m3 T C 2: 85,838,614 (GRCm39) Y165H probably benign Het
Or8d2b A G 9: 38,788,609 (GRCm39) I46V probably damaging Het
Or9a4 T A 6: 40,549,090 (GRCm39) F257I probably damaging Het
Pcdhb5 T A 18: 37,455,734 (GRCm39) S705T possibly damaging Het
Pcgf2 A T 11: 97,584,282 (GRCm39) Y24* probably null Het
Phf14 C T 6: 11,987,096 (GRCm39) P559S probably damaging Het
Pigf A G 17: 87,331,184 (GRCm39) I46T probably benign Het
Plpp4 A G 7: 128,909,356 (GRCm39) E22G probably damaging Het
Prdm10 A G 9: 31,227,590 (GRCm39) E65G possibly damaging Het
Sash1 A G 10: 8,606,006 (GRCm39) S795P possibly damaging Het
Slc22a21 T C 11: 53,860,329 (GRCm39) D34G probably damaging Het
Spata13 T A 14: 60,947,004 (GRCm39) M684K probably damaging Het
Srsf6 T C 2: 162,776,636 (GRCm39) probably benign Het
Stk32c T C 7: 138,700,704 (GRCm39) probably null Het
Tjp1 T C 7: 64,972,898 (GRCm39) D514G probably damaging Het
Ttll11 TCGCCGCCGCCGCCGCCGCCGC TCGCCGCCGCCGCCGCCGC 2: 35,869,564 (GRCm39) probably benign Het
Unc13c A G 9: 73,641,786 (GRCm39) S1236P probably damaging Het
Utp20 G T 10: 88,590,381 (GRCm39) D2364E possibly damaging Het
Vmn1r192 T A 13: 22,371,465 (GRCm39) I252F probably damaging Het
Vmn1r76 T C 7: 11,665,057 (GRCm39) I52M probably benign Het
Xndc1 T A 7: 101,730,694 (GRCm39) L288M possibly damaging Het
Zfp451 A T 1: 33,816,836 (GRCm39) F154L probably damaging Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83,358,750 (GRCm39) nonsense probably null
IGL01154:Aldh1l2 APN 10 83,356,237 (GRCm39) missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83,363,240 (GRCm39) missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83,328,531 (GRCm39) missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83,356,126 (GRCm39) splice site probably benign
IGL02179:Aldh1l2 APN 10 83,358,701 (GRCm39) missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83,331,759 (GRCm39) missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83,328,448 (GRCm39) nonsense probably null
IGL02727:Aldh1l2 APN 10 83,342,469 (GRCm39) missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83,358,777 (GRCm39) missense probably benign 0.17
Hunger_winter UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
Spartan UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83,363,199 (GRCm39) missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83,358,551 (GRCm39) splice site probably benign
R0302:Aldh1l2 UTSW 10 83,356,229 (GRCm39) missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83,326,478 (GRCm39) missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83,354,542 (GRCm39) missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83,354,494 (GRCm39) splice site probably null
R0788:Aldh1l2 UTSW 10 83,352,028 (GRCm39) missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83,344,487 (GRCm39) missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83,331,889 (GRCm39) missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83,331,799 (GRCm39) missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83,356,234 (GRCm39) missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83,344,524 (GRCm39) missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83,343,946 (GRCm39) nonsense probably null
R1893:Aldh1l2 UTSW 10 83,328,400 (GRCm39) missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83,338,389 (GRCm39) missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83,342,607 (GRCm39) missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83,363,177 (GRCm39) missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83,348,228 (GRCm39) missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83,342,518 (GRCm39) missense possibly damaging 0.50
R4296:Aldh1l2 UTSW 10 83,358,641 (GRCm39) missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83,349,486 (GRCm39) missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83,344,556 (GRCm39) missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83,363,271 (GRCm39) missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83,358,649 (GRCm39) missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83,337,789 (GRCm39) missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83,356,189 (GRCm39) missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83,356,244 (GRCm39) missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83,343,998 (GRCm39) nonsense probably null
R6161:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83,329,288 (GRCm39) splice site probably null
R6189:Aldh1l2 UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83,350,408 (GRCm39) missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83,338,321 (GRCm39) missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83,343,969 (GRCm39) missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83,343,975 (GRCm39) missense probably benign
R7848:Aldh1l2 UTSW 10 83,335,707 (GRCm39) missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83,326,479 (GRCm39) missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83,337,785 (GRCm39) missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83,342,506 (GRCm39) missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83,344,541 (GRCm39) missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83,342,545 (GRCm39) missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83,342,510 (GRCm39) missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83,331,816 (GRCm39) nonsense probably null
R9784:Aldh1l2 UTSW 10 83,342,614 (GRCm39) critical splice acceptor site probably null
Z1177:Aldh1l2 UTSW 10 83,369,869 (GRCm39) missense probably benign
Z1177:Aldh1l2 UTSW 10 83,329,344 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGTCATGTTATAAATACCACTTGG -3'
(R):5'- CCAGGAGCATCCACTTTCATGA -3'

Sequencing Primer
(F):5'- AGCCAGTATTCTGCTAGCAG -3'
(R):5'- CCACTTTCATGACTAAAGGCAGGTG -3'
Posted On 2015-06-20