Mutagenetix > Incidental Mutations

Incidental Mutation 'R4295:Utp20'

323272

Institutional Source

Beutler Lab

Gene Symbol

Utp20

Ensembl Gene

ENSMUSG00000004356

Gene Name

UTP20 small subunit processome component

Synonyms

3830408P06Rik, DRIM, mDRIM

MMRRC Submission

041084-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R4295 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88746607-88826804 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 88754519 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 2364 (D2364E)

Ref Sequence

ENSEMBL: ENSMUSP00000004470 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004470]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000004470
AA Change: D2364E

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: D2364E

Domain	Start	End	E-Value	Type
low complexity region	244	255	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC
low complexity region	571	581	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
Pfam:DRIM	910	1534	2.6e-176	PFAM
low complexity region	1585	1598	N/A	INTRINSIC
low complexity region	1705	1719	N/A	INTRINSIC
low complexity region	2503	2513	N/A	INTRINSIC
low complexity region	2589	2605	N/A	INTRINSIC
low complexity region	2727	2737	N/A	INTRINSIC
low complexity region	2746	2764	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	C	13: 119,469,713	S164P	probably benign	Het
4933427D06Rik	A	G	6: 89,107,901		noncoding transcript	Het
Aldh1l2	C	T	10: 83,495,920	V674M	possibly damaging	Het
Angel1	A	G	12: 86,720,283	Y440H	probably damaging	Het
Atr	A	G	9: 95,874,426	I870V	probably benign	Het
C330027C09Rik	T	A	16: 49,013,249	F571Y	probably benign	Het
Cd200r4	T	C	16: 44,832,876	V3A	probably damaging	Het
Celf2	T	C	2: 6,604,064	N302S	probably benign	Het
Dnah17	A	T	11: 118,118,772	I363N	probably damaging	Het
Fam98a	A	T	17: 75,541,347	M124K	probably damaging	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Foxj3	G	T	4: 119,626,297	G555*	probably null	Het
Gm4841	T	C	18: 60,270,190	N277S	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Kif18a	T	C	2: 109,293,053	V224A	probably benign	Het
Lamb2	A	G	9: 108,486,211	D863G	probably benign	Het
Lbr	C	T	1: 181,820,702	C398Y	probably damaging	Het
Lcn11	G	A	2: 25,778,099	A90T	possibly damaging	Het
Olfr1032	T	C	2: 86,008,270	Y165H	probably benign	Het
Olfr1396	T	A	11: 49,113,427	I100L	probably benign	Het
Olfr310	A	T	7: 86,269,760	F10I	probably damaging	Het
Olfr460	T	A	6: 40,572,156	F257I	probably damaging	Het
Olfr926	A	G	9: 38,877,313	I46V	probably damaging	Het
Pcdhb5	T	A	18: 37,322,681	S705T	possibly damaging	Het
Pcgf2	A	T	11: 97,693,456	Y24*	probably null	Het
Phf14	C	T	6: 11,987,097	P559S	probably damaging	Het
Pigf	A	G	17: 87,023,756	I46T	probably benign	Het
Plpp4	A	G	7: 129,307,632	E22G	probably damaging	Het
Prdm10	A	G	9: 31,316,294	E65G	possibly damaging	Het
Sash1	A	G	10: 8,730,242	S795P	possibly damaging	Het
Slc22a21	T	C	11: 53,969,503	D34G	probably damaging	Het
Spata13	T	A	14: 60,709,555	M684K	probably damaging	Het
Srsf6	T	C	2: 162,934,716		probably benign	Het
Stk32c	T	C	7: 139,120,788		probably null	Het
Tjp1	T	C	7: 65,323,150	D514G	probably damaging	Het
Ttll11	TCGCCGCCGCCGCCGCCGCCGC	TCGCCGCCGCCGCCGCCGC	2: 35,979,552		probably benign	Het
Unc13c	A	G	9: 73,734,504	S1236P	probably damaging	Het
Vmn1r192	T	A	13: 22,187,295	I252F	probably damaging	Het
Vmn1r76	T	C	7: 11,931,130	I52M	probably benign	Het
Xndc1	T	A	7: 102,081,487	L288M	possibly damaging	Het
Zfp451	A	T	1: 33,777,755	F154L	probably damaging	Het

Other mutations in Utp20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Utp20	APN	10	88825444	missense	possibly damaging	0.90
IGL00858:Utp20	APN	10	88809125	missense	possibly damaging	0.69
IGL00858:Utp20	APN	10	88809138	missense	probably benign
IGL00946:Utp20	APN	10	88748315	missense	possibly damaging	0.82
IGL01061:Utp20	APN	10	88770704	missense	probably benign	0.13
IGL01399:Utp20	APN	10	88758302	critical splice donor site	probably null
IGL01548:Utp20	APN	10	88764781	missense	probably damaging	1.00
IGL01587:Utp20	APN	10	88787535	missense	probably damaging	0.98
IGL01789:Utp20	APN	10	88798279	critical splice donor site	probably null
IGL01819:Utp20	APN	10	88792687	missense	probably damaging	1.00
IGL02070:Utp20	APN	10	88821877	splice site	probably benign
IGL02231:Utp20	APN	10	88791168	missense	probably damaging	1.00
IGL02244:Utp20	APN	10	88815956	splice site	probably benign
IGL02367:Utp20	APN	10	88771853	unclassified	probably benign
IGL02553:Utp20	APN	10	88764795	missense	probably damaging	0.99
IGL02748:Utp20	APN	10	88817295	missense	probably benign	0.00
IGL02831:Utp20	APN	10	88815908	missense	probably benign
IGL02986:Utp20	APN	10	88775285	missense	probably damaging	1.00
IGL02997:Utp20	APN	10	88814034	missense	probably benign
IGL03105:Utp20	APN	10	88791096	missense	probably benign	0.10
IGL03251:Utp20	APN	10	88817326	critical splice acceptor site	probably null
IGL03337:Utp20	APN	10	88754566	missense	probably benign
IGL03348:Utp20	APN	10	88758317	missense	probably benign	0.09
IGL03381:Utp20	APN	10	88822005	missense	probably damaging	0.99
R0037:Utp20	UTSW	10	88798404	missense	probably benign	0.05
R0107:Utp20	UTSW	10	88778391	missense	probably benign	0.03
R0197:Utp20	UTSW	10	88777516	missense	probably benign	0.22
R0219:Utp20	UTSW	10	88764675	missense	probably damaging	1.00
R0315:Utp20	UTSW	10	88807421	missense	probably damaging	1.00
R0328:Utp20	UTSW	10	88767107	missense	possibly damaging	0.82
R0329:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0330:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0395:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R0399:Utp20	UTSW	10	88820979	missense	probably damaging	1.00
R0454:Utp20	UTSW	10	88822069	missense	probably benign	0.00
R0456:Utp20	UTSW	10	88754573	missense	possibly damaging	0.92
R0491:Utp20	UTSW	10	88760912	missense	probably damaging	1.00
R0557:Utp20	UTSW	10	88748311	missense	probably damaging	0.99
R0600:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R0616:Utp20	UTSW	10	88770751	missense	probably benign	0.14
R1076:Utp20	UTSW	10	88772459	missense	probably benign	0.36
R1076:Utp20	UTSW	10	88772543	missense	possibly damaging	0.86
R1330:Utp20	UTSW	10	88801189	missense	probably damaging	0.96
R1440:Utp20	UTSW	10	88819339	missense	probably benign	0.19
R1529:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R1554:Utp20	UTSW	10	88764737	nonsense	probably null
R1621:Utp20	UTSW	10	88762871	missense	probably benign
R1641:Utp20	UTSW	10	88757972	missense	possibly damaging	0.82
R1709:Utp20	UTSW	10	88749297	missense	probably benign	0.29
R1734:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R1755:Utp20	UTSW	10	88809769	missense	probably benign	0.01
R1775:Utp20	UTSW	10	88770808	missense	probably benign
R1866:Utp20	UTSW	10	88762770	nonsense	probably null
R1867:Utp20	UTSW	10	88749443	missense	probably benign
R1901:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1902:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1967:Utp20	UTSW	10	88816979	missense	probably benign	0.03
R2060:Utp20	UTSW	10	88774795	missense	probably damaging	0.98
R2102:Utp20	UTSW	10	88772917	missense	probably damaging	0.99
R2110:Utp20	UTSW	10	88767451	critical splice donor site	probably null
R2115:Utp20	UTSW	10	88786003	missense	probably benign	0.02
R2128:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2129:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2180:Utp20	UTSW	10	88820939	missense	probably damaging	0.98
R2280:Utp20	UTSW	10	88825503	splice site	probably null
R2435:Utp20	UTSW	10	88820891	missense	possibly damaging	0.89
R2914:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R3005:Utp20	UTSW	10	88777455	missense	probably damaging	0.97
R3546:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3547:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3622:Utp20	UTSW	10	88757993	unclassified	probably benign
R3737:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3738:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3841:Utp20	UTSW	10	88775203	unclassified	probably benign
R4034:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4035:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4157:Utp20	UTSW	10	88761867	missense	probably benign
R4243:Utp20	UTSW	10	88807325	critical splice donor site	probably null
R4632:Utp20	UTSW	10	88778261	missense	probably damaging	1.00
R4633:Utp20	UTSW	10	88752952	missense	probably benign
R4684:Utp20	UTSW	10	88807445	nonsense	probably null
R4731:Utp20	UTSW	10	88754520	missense	possibly damaging	0.93
R4735:Utp20	UTSW	10	88816918	missense	possibly damaging	0.91
R4772:Utp20	UTSW	10	88809935	missense	probably benign	0.09
R4912:Utp20	UTSW	10	88771960	missense	probably benign	0.01
R4974:Utp20	UTSW	10	88816949	missense	probably benign	0.08
R4991:Utp20	UTSW	10	88746934	missense	probably benign	0.09
R5004:Utp20	UTSW	10	88748273	missense	probably damaging	0.98
R5037:Utp20	UTSW	10	88775330	missense	probably benign	0.00
R5043:Utp20	UTSW	10	88798746	missense	possibly damaging	0.70
R5108:Utp20	UTSW	10	88768873	missense	probably benign	0.00
R5138:Utp20	UTSW	10	88747377	missense	probably damaging	0.96
R5252:Utp20	UTSW	10	88750670	missense	probably benign	0.01
R5394:Utp20	UTSW	10	88772915	nonsense	probably null
R5470:Utp20	UTSW	10	88817896	missense	probably benign	0.14
R5558:Utp20	UTSW	10	88751467	missense	probably damaging	1.00
R5678:Utp20	UTSW	10	88809117	missense	probably benign	0.00
R5822:Utp20	UTSW	10	88817285	missense	probably benign	0.00
R5866:Utp20	UTSW	10	88772559	missense	possibly damaging	0.82
R5924:Utp20	UTSW	10	88815922	missense	probably benign	0.00
R6026:Utp20	UTSW	10	88768679	missense	probably benign	0.04
R6363:Utp20	UTSW	10	88757080	missense	probably damaging	1.00
R6434:Utp20	UTSW	10	88772533	nonsense	probably null
R6477:Utp20	UTSW	10	88768918	missense	probably benign	0.05
R6480:Utp20	UTSW	10	88755186	critical splice donor site	probably null
R6989:Utp20	UTSW	10	88778240	missense	probably benign	0.00
R7033:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R7192:Utp20	UTSW	10	88772459	missense	probably benign	0.09
R7236:Utp20	UTSW	10	88749342	missense	probably benign	0.28
R7260:Utp20	UTSW	10	88751472	missense	probably benign	0.39
R7296:Utp20	UTSW	10	88770724	missense	probably benign	0.21
R7317:Utp20	UTSW	10	88762935	missense	possibly damaging	0.83
R7318:Utp20	UTSW	10	88813949	missense	possibly damaging	0.89
R7330:Utp20	UTSW	10	88787562	frame shift	probably null
R7367:Utp20	UTSW	10	88795443	missense	probably benign	0.21
R7432:Utp20	UTSW	10	88798398	missense	probably benign	0.00
R7447:Utp20	UTSW	10	88772492	missense	probably damaging	1.00
R7520:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R7530:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R7539:Utp20	UTSW	10	88791745	missense	probably damaging	1.00
R7651:Utp20	UTSW	10	88754595	missense	probably benign	0.41
R7728:Utp20	UTSW	10	88798341	missense	probably damaging	1.00
RF005:Utp20	UTSW	10	88825457	missense	probably damaging	1.00
RF024:Utp20	UTSW	10	88825457	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGTTACTCTCTACGGCTTC -3'
(R):5'- AGGCACTTCCATTCTCACCG -3'

Sequencing Primer
(F):5'- ACTTCGCGCCAGTTTAAGAG -3'
(R):5'- ATTCTCACCGGTGCCTGC -3'

Posted On

2015-06-20