Incidental Mutation 'R4295:Slc22a21'
ID323274
Institutional Source Beutler Lab
Gene Symbol Slc22a21
Ensembl Gene ENSMUSG00000063652
Gene Namesolute carrier family 22 (organic cation transporter), member 21
SynonymsOctn3, Slc22a9
MMRRC Submission 041084-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4295 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53949965-53980332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53969503 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 34 (D34G)
Ref Sequence ENSEMBL: ENSMUSP00000114966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076493] [ENSMUST00000124221] [ENSMUST00000143352]
Predicted Effect probably damaging
Transcript: ENSMUST00000076493
AA Change: D165G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075814
Gene: ENSMUSG00000063652
AA Change: D165G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 74 527 3.1e-31 PFAM
Pfam:MFS_1 139 376 3e-13 PFAM
low complexity region 528 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119198
Predicted Effect probably damaging
Transcript: ENSMUST00000124221
AA Change: D165G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123180
Gene: ENSMUSG00000063652
AA Change: D165G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143352
AA Change: D34G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9610 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,713 S164P probably benign Het
4933427D06Rik A G 6: 89,107,901 noncoding transcript Het
Aldh1l2 C T 10: 83,495,920 V674M possibly damaging Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Atr A G 9: 95,874,426 I870V probably benign Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cd200r4 T C 16: 44,832,876 V3A probably damaging Het
Celf2 T C 2: 6,604,064 N302S probably benign Het
Dnah17 A T 11: 118,118,772 I363N probably damaging Het
Fam98a A T 17: 75,541,347 M124K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Foxj3 G T 4: 119,626,297 G555* probably null Het
Gm4841 T C 18: 60,270,190 N277S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lamb2 A G 9: 108,486,211 D863G probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lcn11 G A 2: 25,778,099 A90T possibly damaging Het
Olfr1032 T C 2: 86,008,270 Y165H probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr460 T A 6: 40,572,156 F257I probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Pcgf2 A T 11: 97,693,456 Y24* probably null Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pigf A G 17: 87,023,756 I46T probably benign Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Prdm10 A G 9: 31,316,294 E65G possibly damaging Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tjp1 T C 7: 65,323,150 D514G probably damaging Het
Ttll11 TCGCCGCCGCCGCCGCCGCCGC TCGCCGCCGCCGCCGCCGC 2: 35,979,552 probably benign Het
Unc13c A G 9: 73,734,504 S1236P probably damaging Het
Utp20 G T 10: 88,754,519 D2364E possibly damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn1r76 T C 7: 11,931,130 I52M probably benign Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfp451 A T 1: 33,777,755 F154L probably damaging Het
Other mutations in Slc22a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Slc22a21 APN 11 53979581 missense probably damaging 1.00
R0025:Slc22a21 UTSW 11 53979688 missense probably damaging 1.00
R0104:Slc22a21 UTSW 11 53951809 missense probably null 0.88
R0285:Slc22a21 UTSW 11 53959196 splice site probably benign
R0562:Slc22a21 UTSW 11 53979620 nonsense probably null
R0569:Slc22a21 UTSW 11 53951810 missense probably benign 0.00
R1237:Slc22a21 UTSW 11 53979772 missense probably benign 0.36
R2131:Slc22a21 UTSW 11 53979733 missense probably damaging 1.00
R2327:Slc22a21 UTSW 11 53951304 missense probably benign 0.25
R2991:Slc22a21 UTSW 11 53959369 missense probably damaging 1.00
R4209:Slc22a21 UTSW 11 53956055 missense probably benign 0.00
R4290:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4291:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4292:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4294:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4470:Slc22a21 UTSW 11 53956013 missense probably benign 0.00
R5194:Slc22a21 UTSW 11 53979847 missense probably damaging 1.00
R5214:Slc22a21 UTSW 11 53953043 missense probably damaging 0.99
R5698:Slc22a21 UTSW 11 53951349 missense probably benign 0.04
R6169:Slc22a21 UTSW 11 53958087 missense probably damaging 1.00
R6200:Slc22a21 UTSW 11 53958038 missense probably damaging 1.00
R6767:Slc22a21 UTSW 11 53979502 missense probably damaging 1.00
R6845:Slc22a21 UTSW 11 53979640 missense probably benign 0.01
R7109:Slc22a21 UTSW 11 53979503 missense possibly damaging 0.88
R7402:Slc22a21 UTSW 11 53960400 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGACTGACTCAGGTTCCTTTG -3'
(R):5'- GAGGCCACCTGTTTTCTCTG -3'

Sequencing Primer
(F):5'- GACTGACTCAGGTTCCTTTGTTCAG -3'
(R):5'- CATTGCTGCCCAGGTGAGTC -3'
Posted On2015-06-20