Incidental Mutation 'R0003:Dock1'
ID32328
Institutional Source Beutler Lab
Gene Symbol Dock1
Ensembl Gene ENSMUSG00000058325
Gene Namededicator of cytokinesis 1
SynonymsD630004B07Rik, Dock180, 9130006G06Rik
MMRRC Submission 038299-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0003 (G1)
Quality Score145
Status Validated
Chromosome7
Chromosomal Location134670654-135173639 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 134730064 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084488] [ENSMUST00000211593]
Predicted Effect probably benign
Transcript: ENSMUST00000084488
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211570
Predicted Effect probably benign
Transcript: ENSMUST00000211593
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Dedicator of cytokinesis proteins act as guanine nucleotide exchange factors for small Rho family G proteins. The encoded protein regulates the small GTPase Rac, thereby influencing several biological processes, including phagocytosis and cell migration. Overexpression of this gene has also been associated with certain cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,578 V1903E possibly damaging Het
Adam19 T A 11: 46,128,789 C439S probably damaging Het
Adnp2 T C 18: 80,130,990 Y68C probably damaging Het
Ahctf1 A T 1: 179,763,473 D1247E probably benign Het
Alms1 T A 6: 85,629,210 M2614K possibly damaging Het
Alx3 A G 3: 107,604,976 H310R probably damaging Het
Ambra1 C T 2: 91,911,428 T1016M probably damaging Het
Ankrd35 A G 3: 96,684,015 E539G probably damaging Het
Aptx A G 4: 40,695,145 probably benign Het
Arsi C T 18: 60,916,986 R314C probably benign Het
Atp1a3 T C 7: 24,989,564 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
BC067074 T A 13: 113,368,776 S2146R probably benign Het
Bicra G T 7: 15,971,887 T1543K probably benign Het
Bzw2 A C 12: 36,130,015 I71S probably damaging Het
Camk2a C T 18: 60,960,007 A302V probably damaging Het
Ccdc12 A G 9: 110,656,597 E12G possibly damaging Het
Cd300lb A T 11: 114,928,338 F19Y probably benign Het
Clcn3 A T 8: 60,927,296 C535* probably null Het
Cntnap5c A G 17: 58,199,017 T679A probably benign Het
Cpsf7 G A 19: 10,539,629 S365N possibly damaging Het
Cyp20a1 T C 1: 60,387,126 probably benign Het
Decr2 A T 17: 26,083,053 N234K probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dnah12 T C 14: 26,772,644 F1300L probably damaging Het
Dpy19l4 A T 4: 11,267,619 N440K probably damaging Het
Eprs T C 1: 185,414,391 V1206A probably damaging Het
Exoc6b A G 6: 84,854,699 probably null Het
Fam184b A G 5: 45,555,194 probably benign Het
Fcho1 A T 8: 71,708,953 S858T probably damaging Het
Fgfr1 A G 8: 25,568,198 D430G possibly damaging Het
Fmnl3 T C 15: 99,321,132 T807A probably damaging Het
Gabra5 T C 7: 57,413,728 Y316C probably damaging Het
Gh A G 11: 106,301,520 L16P probably damaging Het
Glipr2 A T 4: 43,970,532 I87F probably damaging Het
Glrb T A 3: 80,855,914 I259F probably damaging Het
Gpr63 T C 4: 25,007,651 L125P probably damaging Het
Grb2 A G 11: 115,655,425 Y37H probably damaging Het
Haus2 G A 2: 120,618,968 probably benign Het
Hmgcr T C 13: 96,652,145 N749S probably damaging Het
Igf1r T C 7: 68,165,242 V297A probably damaging Het
Il12rb2 G T 6: 67,316,286 P69H probably damaging Het
Ints3 C A 3: 90,408,511 M315I probably benign Het
Izumo2 C T 7: 44,715,409 T116I probably benign Het
Kctd19 A C 8: 105,395,361 Y185D probably damaging Het
Lama4 A G 10: 39,060,222 N631S possibly damaging Het
Lama5 T G 2: 180,178,079 probably null Het
Lamc1 A C 1: 153,262,439 L223R probably damaging Het
Lgr4 G A 2: 109,997,665 probably null Het
Loxhd1 T C 18: 77,339,500 L398P probably damaging Het
Mapk9 T A 11: 49,867,039 D103E possibly damaging Het
March6 T C 15: 31,469,532 probably benign Het
Mlxipl G A 5: 135,133,189 probably benign Het
Mrgbp C A 2: 180,583,438 D62E probably benign Het
Mtap A T 4: 89,151,998 probably benign Het
Myt1 G A 2: 181,801,871 G497S probably damaging Het
Naa25 T G 5: 121,407,184 probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkpd1 T C 7: 19,519,927 C73R probably benign Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Nvl C A 1: 181,114,133 D581Y probably damaging Het
Olfr1102 T A 2: 87,002,366 Y132* probably null Het
Olfr1500 T C 19: 13,827,686 T237A probably damaging Het
Olfr568 T C 7: 102,877,861 V247A probably benign Het
Olfr575 T C 7: 102,954,978 M208V probably benign Het
Olfr905 A G 9: 38,473,316 T190A probably benign Het
Pcdh7 G T 5: 57,913,248 E1089D probably benign Het
Pik3cd A G 4: 149,656,379 probably null Het
Plekhh2 A T 17: 84,557,392 K69N probably damaging Het
Ptgdr2 G A 19: 10,940,428 C103Y probably damaging Het
Rrad A C 8: 104,628,667 H236Q probably benign Het
Rslcan18 C T 13: 67,098,469 A236T probably benign Het
Ryr2 C A 13: 11,824,379 D503Y probably damaging Het
Siglec1 T C 2: 131,075,060 T1092A probably benign Het
Siglecf A G 7: 43,355,926 T437A probably benign Het
Spta1 A T 1: 174,205,273 Q965H probably damaging Het
Stk10 A T 11: 32,589,460 E280V probably benign Het
Tfg T C 16: 56,690,988 Y326C possibly damaging Het
Tpp2 T A 1: 43,960,139 S358T possibly damaging Het
Trim25 G T 11: 89,015,772 V437L probably benign Het
Ttn T C 2: 76,743,683 D25622G probably damaging Het
Ube3b T A 5: 114,398,851 S303R probably benign Het
Ush2a T A 1: 188,578,491 V2088D probably damaging Het
Vmn2r103 A G 17: 19,811,979 T672A probably damaging Het
Wdr11 G T 7: 129,599,061 G79C probably damaging Het
Wdr89 T A 12: 75,632,593 T296S probably benign Het
Zdhhc24 T A 19: 4,880,374 L179M possibly damaging Het
Zfp981 T C 4: 146,537,760 C381R probably damaging Het
Zim1 A G 7: 6,676,948 I572T probably benign Het
Other mutations in Dock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Dock1 APN 7 135146531 splice site probably benign
IGL01319:Dock1 APN 7 134789278 missense probably benign
IGL01390:Dock1 APN 7 134745047 missense possibly damaging 0.95
IGL01394:Dock1 APN 7 134766216 missense probably benign 0.01
IGL01489:Dock1 APN 7 134999321 splice site probably benign
IGL01505:Dock1 APN 7 135158510 missense possibly damaging 0.91
IGL01586:Dock1 APN 7 134753377 missense probably damaging 1.00
IGL01637:Dock1 APN 7 135137813 critical splice acceptor site probably null
IGL01649:Dock1 APN 7 134777410 missense probably damaging 1.00
IGL01652:Dock1 APN 7 134777497 splice site probably benign
IGL01859:Dock1 APN 7 135077161 missense possibly damaging 0.51
IGL02068:Dock1 APN 7 134771548 missense probably benign 0.26
IGL02168:Dock1 APN 7 135077131 splice site probably benign
IGL02200:Dock1 APN 7 134744271 missense probably benign 0.01
IGL02244:Dock1 APN 7 134777445 nonsense probably null
IGL02285:Dock1 APN 7 135081920 critical splice donor site probably null
IGL02319:Dock1 APN 7 134772449 missense possibly damaging 0.94
IGL02334:Dock1 APN 7 135145565 missense probably damaging 1.00
IGL02338:Dock1 APN 7 135133075 missense possibly damaging 0.95
IGL02351:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02358:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02607:Dock1 APN 7 134851513 missense probably benign 0.13
IGL02638:Dock1 APN 7 135146480 missense probably benign 0.09
IGL02724:Dock1 APN 7 135163353 missense probably benign
IGL02820:Dock1 APN 7 135167215 missense probably benign 0.11
IGL02950:Dock1 APN 7 134730024 missense probably damaging 1.00
IGL02993:Dock1 APN 7 134744298 missense probably benign
IGL03000:Dock1 APN 7 134789240 missense probably benign 0.17
IGL03092:Dock1 APN 7 134765216 splice site probably benign
IGL03131:Dock1 APN 7 134874183 missense possibly damaging 0.80
IGL03136:Dock1 APN 7 135168389 missense probably benign 0.00
IGL03210:Dock1 APN 7 134756939 missense possibly damaging 0.62
IGL03220:Dock1 APN 7 135108522 critical splice donor site probably null
P0028:Dock1 UTSW 7 134999324 splice site probably benign
PIT4453001:Dock1 UTSW 7 135152300 missense probably benign
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0179:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0180:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0347:Dock1 UTSW 7 134763867 missense probably damaging 1.00
R0399:Dock1 UTSW 7 135163442 missense probably benign 0.00
R0457:Dock1 UTSW 7 135138145 missense possibly damaging 0.90
R0480:Dock1 UTSW 7 134737718 missense probably damaging 1.00
R0521:Dock1 UTSW 7 135143778 missense probably benign 0.21
R0792:Dock1 UTSW 7 134874150 missense probably benign 0.02
R1136:Dock1 UTSW 7 134848173 missense possibly damaging 0.95
R1224:Dock1 UTSW 7 135108819 missense possibly damaging 0.67
R1267:Dock1 UTSW 7 134746436 missense probably damaging 1.00
R1373:Dock1 UTSW 7 135167175 missense probably benign 0.01
R1401:Dock1 UTSW 7 135133936 nonsense probably null
R1454:Dock1 UTSW 7 134851609 splice site probably benign
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1523:Dock1 UTSW 7 134744247 missense possibly damaging 0.49
R1643:Dock1 UTSW 7 135098779 missense probably damaging 1.00
R1659:Dock1 UTSW 7 134789243 missense probably damaging 0.98
R1793:Dock1 UTSW 7 135098727 splice site probably null
R1864:Dock1 UTSW 7 135146507 missense probably benign 0.07
R1911:Dock1 UTSW 7 134999300 missense probably damaging 1.00
R2567:Dock1 UTSW 7 135145484 missense probably damaging 1.00
R3816:Dock1 UTSW 7 134744286 nonsense probably null
R3971:Dock1 UTSW 7 134746908 missense probably damaging 1.00
R4063:Dock1 UTSW 7 135115292 missense possibly damaging 0.81
R4163:Dock1 UTSW 7 134744322 missense possibly damaging 0.79
R4271:Dock1 UTSW 7 134734054 missense probably damaging 0.99
R4684:Dock1 UTSW 7 134724409 nonsense probably null
R4717:Dock1 UTSW 7 134848170 missense probably damaging 1.00
R4725:Dock1 UTSW 7 134745014 nonsense probably null
R4788:Dock1 UTSW 7 135145484 missense probably damaging 0.98
R4869:Dock1 UTSW 7 134734071 missense probably damaging 1.00
R4889:Dock1 UTSW 7 134744976 missense probably benign 0.02
R4953:Dock1 UTSW 7 135152288 missense probably benign 0.34
R5031:Dock1 UTSW 7 135152246 missense probably benign 0.02
R5161:Dock1 UTSW 7 134734062 missense possibly damaging 0.69
R5168:Dock1 UTSW 7 135118908 missense probably damaging 1.00
R5212:Dock1 UTSW 7 134789194 missense possibly damaging 0.68
R5648:Dock1 UTSW 7 134746954 missense probably damaging 1.00
R5685:Dock1 UTSW 7 134772362 missense probably benign 0.19
R5834:Dock1 UTSW 7 134763933 missense probably damaging 1.00
R6181:Dock1 UTSW 7 135158522 missense probably damaging 1.00
R6334:Dock1 UTSW 7 134851576 missense probably benign 0.01
R6406:Dock1 UTSW 7 135145486 missense probably benign 0.26
R6425:Dock1 UTSW 7 135163381 missense possibly damaging 0.79
R6489:Dock1 UTSW 7 134990541 missense probably damaging 0.99
R6616:Dock1 UTSW 7 135108492 missense possibly damaging 0.85
R6706:Dock1 UTSW 7 135133886 missense possibly damaging 0.72
R6766:Dock1 UTSW 7 134756793 intron probably null
R6861:Dock1 UTSW 7 134771478 missense probably benign 0.00
R6985:Dock1 UTSW 7 135163403 missense possibly damaging 0.95
R7259:Dock1 UTSW 7 134782748 missense probably damaging 0.99
R7285:Dock1 UTSW 7 134745008 missense probably benign 0.01
R7471:Dock1 UTSW 7 135163343 missense possibly damaging 0.65
R7497:Dock1 UTSW 7 134765274 missense probably benign
R7691:Dock1 UTSW 7 135138157 critical splice donor site probably null
R7732:Dock1 UTSW 7 134744970 missense probably benign 0.01
R7818:Dock1 UTSW 7 134763865 missense probably damaging 1.00
X0062:Dock1 UTSW 7 135108451 missense probably damaging 1.00
Z1088:Dock1 UTSW 7 134804547 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTTGTGAGACTCTGGCTGCTCC -3'
(R):5'- AGCATTCCCAGCAGAAGCTGTG -3'

Sequencing Primer
(F):5'- TCTTGAGTCAGATCAGCAGATG -3'
(R):5'- CCAGCAGAAGCTGTGATTTC -3'
Posted On2013-05-09